ID: 1069778072

View in Genome Browser
Species Human (GRCh38)
Location 10:70938304-70938326
Sequence CTGGATCCTCAGATCGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069778072_1069778078 -4 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778078 10:70938323-70938345 CCAGCAGCCCATTCCGCAGGGGG No data
1069778072_1069778085 27 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778085 10:70938354-70938376 GCTCTGCTTCCAGAAAATTAGGG No data
1069778072_1069778074 -7 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778074 10:70938320-70938342 GATCCAGCAGCCCATTCCGCAGG No data
1069778072_1069778075 -6 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778075 10:70938321-70938343 ATCCAGCAGCCCATTCCGCAGGG No data
1069778072_1069778076 -5 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778076 10:70938322-70938344 TCCAGCAGCCCATTCCGCAGGGG No data
1069778072_1069778084 26 Left 1069778072 10:70938304-70938326 CCCAAATCGATCTGAGGATCCAG No data
Right 1069778084 10:70938353-70938375 TGCTCTGCTTCCAGAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069778072 Original CRISPR CTGGATCCTCAGATCGATTT GGG (reversed) Intergenic
No off target data available for this crispr