ID: 1069778347

View in Genome Browser
Species Human (GRCh38)
Location 10:70939736-70939758
Sequence GTCCAAAGGATTCCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069778344_1069778347 0 Left 1069778344 10:70939713-70939735 CCAAGGTAACCAAAGGACATTTA No data
Right 1069778347 10:70939736-70939758 GTCCAAAGGATTCCAAAGAAAGG No data
1069778345_1069778347 -9 Left 1069778345 10:70939722-70939744 CCAAAGGACATTTAGTCCAAAGG No data
Right 1069778347 10:70939736-70939758 GTCCAAAGGATTCCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069778347 Original CRISPR GTCCAAAGGATTCCAAAGAA AGG Intergenic
No off target data available for this crispr