ID: 1069780356

View in Genome Browser
Species Human (GRCh38)
Location 10:70951552-70951574
Sequence CCTTATTTATGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069780356_1069780369 21 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780369 10:70951596-70951618 GCAAGCAAGTAGAGAAGTGGTGG No data
1069780356_1069780362 -7 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780362 10:70951568-70951590 AATAAGGAGCTTCCATCTATTGG No data
1069780356_1069780364 -2 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780364 10:70951573-70951595 GGAGCTTCCATCTATTGGGCCGG No data
1069780356_1069780368 18 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780368 10:70951593-70951615 CGGGCAAGCAAGTAGAGAAGTGG No data
1069780356_1069780365 -1 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780365 10:70951574-70951596 GAGCTTCCATCTATTGGGCCGGG No data
1069780356_1069780363 -6 Left 1069780356 10:70951552-70951574 CCCTCTGCCCTCCATAAATAAGG No data
Right 1069780363 10:70951569-70951591 ATAAGGAGCTTCCATCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069780356 Original CRISPR CCTTATTTATGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr