ID: 1069783065

View in Genome Browser
Species Human (GRCh38)
Location 10:70969091-70969113
Sequence TGTCACTGACTGAGGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069783065_1069783071 7 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783071 10:70969121-70969143 TATTGATAGTGGCTGGAATGTGG No data
1069783065_1069783072 10 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783072 10:70969124-70969146 TGATAGTGGCTGGAATGTGGTGG No data
1069783065_1069783075 23 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783075 10:70969137-70969159 AATGTGGTGGTGGCTCCCCAGGG No data
1069783065_1069783074 22 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783074 10:70969136-70969158 GAATGTGGTGGTGGCTCCCCAGG No data
1069783065_1069783073 13 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783073 10:70969127-70969149 TAGTGGCTGGAATGTGGTGGTGG No data
1069783065_1069783070 0 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783070 10:70969114-70969136 TTTTCTTTATTGATAGTGGCTGG No data
1069783065_1069783069 -4 Left 1069783065 10:70969091-70969113 CCCACTACCCTCAGTCAGTGACA No data
Right 1069783069 10:70969110-70969132 GACATTTTCTTTATTGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069783065 Original CRISPR TGTCACTGACTGAGGGTAGT GGG (reversed) Intergenic
No off target data available for this crispr