ID: 1069783354

View in Genome Browser
Species Human (GRCh38)
Location 10:70970686-70970708
Sequence CTAGTTCTGTAGGTATTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069783354_1069783357 19 Left 1069783354 10:70970686-70970708 CCCATAAATACCTACAGAACTAG No data
Right 1069783357 10:70970728-70970750 TATTTTCAGACATTGACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069783354 Original CRISPR CTAGTTCTGTAGGTATTTAT GGG (reversed) Intergenic
No off target data available for this crispr