ID: 1069786163

View in Genome Browser
Species Human (GRCh38)
Location 10:70989192-70989214
Sequence GTCACCTCCATTACATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069786163_1069786164 4 Left 1069786163 10:70989192-70989214 CCTGGAAATGTAATGGAGGTGAC No data
Right 1069786164 10:70989219-70989241 GTCACCTCCTTAGACCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069786163 Original CRISPR GTCACCTCCATTACATTTCC AGG (reversed) Intergenic
No off target data available for this crispr