ID: 1069787702

View in Genome Browser
Species Human (GRCh38)
Location 10:70999227-70999249
Sequence CCTCATTCGCACCTGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069787702_1069787710 16 Left 1069787702 10:70999227-70999249 CCTTACTCCAGGTGCGAATGAGG No data
Right 1069787710 10:70999266-70999288 TGAGACATCTGCAGGAATCTAGG No data
1069787702_1069787711 19 Left 1069787702 10:70999227-70999249 CCTTACTCCAGGTGCGAATGAGG No data
Right 1069787711 10:70999269-70999291 GACATCTGCAGGAATCTAGGTGG No data
1069787702_1069787709 8 Left 1069787702 10:70999227-70999249 CCTTACTCCAGGTGCGAATGAGG No data
Right 1069787709 10:70999258-70999280 TCATGACGTGAGACATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069787702 Original CRISPR CCTCATTCGCACCTGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr