ID: 1069789746

View in Genome Browser
Species Human (GRCh38)
Location 10:71012039-71012061
Sequence GCTAGAACTGAGACTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069789746_1069789750 -5 Left 1069789746 10:71012039-71012061 CCTCTCTGAGTCTCAGTTCTAGC No data
Right 1069789750 10:71012057-71012079 CTAGCCACAAGATGGGGATAAGG No data
1069789746_1069789754 18 Left 1069789746 10:71012039-71012061 CCTCTCTGAGTCTCAGTTCTAGC No data
Right 1069789754 10:71012080-71012102 CCTGCTTTGCCTTCTTCTCTGGG No data
1069789746_1069789752 17 Left 1069789746 10:71012039-71012061 CCTCTCTGAGTCTCAGTTCTAGC No data
Right 1069789752 10:71012079-71012101 GCCTGCTTTGCCTTCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069789746 Original CRISPR GCTAGAACTGAGACTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr