ID: 1069790829

View in Genome Browser
Species Human (GRCh38)
Location 10:71019547-71019569
Sequence GACAGCCCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069790829_1069790834 16 Left 1069790829 10:71019547-71019569 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1069790834 10:71019586-71019608 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1069790829_1069790832 11 Left 1069790829 10:71019547-71019569 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1069790832 10:71019581-71019603 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330
1069790829_1069790833 15 Left 1069790829 10:71019547-71019569 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069790829 Original CRISPR GACAGCCCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr