ID: 1069793241

View in Genome Browser
Species Human (GRCh38)
Location 10:71036624-71036646
Sequence GATAAGGGTTCCACCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069793241_1069793247 25 Left 1069793241 10:71036624-71036646 CCTGGCCAGGTGGAACCCTTATC No data
Right 1069793247 10:71036672-71036694 TCTATGATGTGTCAGACACTGGG No data
1069793241_1069793246 24 Left 1069793241 10:71036624-71036646 CCTGGCCAGGTGGAACCCTTATC No data
Right 1069793246 10:71036671-71036693 TTCTATGATGTGTCAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069793241 Original CRISPR GATAAGGGTTCCACCTGGCC AGG (reversed) Intergenic
No off target data available for this crispr