ID: 1069795495

View in Genome Browser
Species Human (GRCh38)
Location 10:71049340-71049362
Sequence GATTATGCAAAGACTGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069795486_1069795495 29 Left 1069795486 10:71049288-71049310 CCCGGCATGTTTGGGAATTTGCT No data
Right 1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG No data
1069795493_1069795495 -6 Left 1069795493 10:71049323-71049345 CCAAGGAAAGTCATAAGGATTAT No data
Right 1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG No data
1069795487_1069795495 28 Left 1069795487 10:71049289-71049311 CCGGCATGTTTGGGAATTTGCTT No data
Right 1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG No data
1069795491_1069795495 4 Left 1069795491 10:71049313-71049335 CCAGGGATTGCCAAGGAAAGTCA No data
Right 1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069795495 Original CRISPR GATTATGCAAAGACTGTTCT GGG Intergenic
No off target data available for this crispr