ID: 1069796440

View in Genome Browser
Species Human (GRCh38)
Location 10:71055224-71055246
Sequence GTGGAGTGGTATCTTATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069796440_1069796442 -9 Left 1069796440 10:71055224-71055246 CCAACAATAAGATACCACTCCAC No data
Right 1069796442 10:71055238-71055260 CCACTCCACACCTCTTAGCATGG No data
1069796440_1069796446 27 Left 1069796440 10:71055224-71055246 CCAACAATAAGATACCACTCCAC No data
Right 1069796446 10:71055274-71055296 ACACTGACAACACCAAATGCTGG 0: 124
1: 336
2: 557
3: 762
4: 1313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069796440 Original CRISPR GTGGAGTGGTATCTTATTGT TGG (reversed) Intergenic
No off target data available for this crispr