ID: 1069796442

View in Genome Browser
Species Human (GRCh38)
Location 10:71055238-71055260
Sequence CCACTCCACACCTCTTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069796440_1069796442 -9 Left 1069796440 10:71055224-71055246 CCAACAATAAGATACCACTCCAC No data
Right 1069796442 10:71055238-71055260 CCACTCCACACCTCTTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069796442 Original CRISPR CCACTCCACACCTCTTAGCA TGG Intergenic