ID: 1069796446

View in Genome Browser
Species Human (GRCh38)
Location 10:71055274-71055296
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069796441_1069796446 13 Left 1069796441 10:71055238-71055260 CCACTCCACACCTCTTAGCATGG No data
Right 1069796446 10:71055274-71055296 ACACTGACAACACCAAATGCTGG No data
1069796443_1069796446 8 Left 1069796443 10:71055243-71055265 CCACACCTCTTAGCATGGCAAAA No data
Right 1069796446 10:71055274-71055296 ACACTGACAACACCAAATGCTGG No data
1069796440_1069796446 27 Left 1069796440 10:71055224-71055246 CCAACAATAAGATACCACTCCAC No data
Right 1069796446 10:71055274-71055296 ACACTGACAACACCAAATGCTGG No data
1069796444_1069796446 3 Left 1069796444 10:71055248-71055270 CCTCTTAGCATGGCAAAAATCCA No data
Right 1069796446 10:71055274-71055296 ACACTGACAACACCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069796446 Original CRISPR ACACTGACAACACCAAATGC TGG Intergenic