ID: 1069799436

View in Genome Browser
Species Human (GRCh38)
Location 10:71072980-71073002
Sequence CCAGCAATGGAGAGTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069799436_1069799444 15 Left 1069799436 10:71072980-71073002 CCAGCTTTACTCTCCATTGCTGG No data
Right 1069799444 10:71073018-71073040 AGGCTGTGTCTCCCAGGCCCTGG No data
1069799436_1069799441 -5 Left 1069799436 10:71072980-71073002 CCAGCTTTACTCTCCATTGCTGG No data
Right 1069799441 10:71072998-71073020 GCTGGGGCACTGACTCCTGCAGG No data
1069799436_1069799442 9 Left 1069799436 10:71072980-71073002 CCAGCTTTACTCTCCATTGCTGG No data
Right 1069799442 10:71073012-71073034 TCCTGCAGGCTGTGTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069799436 Original CRISPR CCAGCAATGGAGAGTAAAGC TGG (reversed) Intergenic
No off target data available for this crispr