ID: 1069802392

View in Genome Browser
Species Human (GRCh38)
Location 10:71090177-71090199
Sequence ATTGATAAGCCCCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069802392_1069802396 -10 Left 1069802392 10:71090177-71090199 CCATCCTCCTGGGGCTTATCAAT No data
Right 1069802396 10:71090190-71090212 GCTTATCAATGAATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069802392 Original CRISPR ATTGATAAGCCCCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr