ID: 1069803163

View in Genome Browser
Species Human (GRCh38)
Location 10:71094987-71095009
Sequence GACTCACTCCCTTATTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069803163_1069803165 0 Left 1069803163 10:71094987-71095009 CCAGTACAATAAGGGAGTGAGTC No data
Right 1069803165 10:71095010-71095032 TGGATTAGTGATCTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069803163 Original CRISPR GACTCACTCCCTTATTGTAC TGG (reversed) Intergenic
No off target data available for this crispr