ID: 1069809619

View in Genome Browser
Species Human (GRCh38)
Location 10:71148743-71148765
Sequence TCTCCATTCCTTAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069809619_1069809626 7 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809626 10:71148773-71148795 GAAAGGTGAGAGAAGTTGCCTGG No data
1069809619_1069809628 12 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809628 10:71148778-71148800 GTGAGAGAAGTTGCCTGGGCAGG No data
1069809619_1069809625 -10 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809625 10:71148756-71148778 GGAATGGAGACTCAAAGGAAAGG No data
1069809619_1069809627 8 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809627 10:71148774-71148796 AAAGGTGAGAGAAGTTGCCTGGG No data
1069809619_1069809631 25 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809631 10:71148791-71148813 CCTGGGCAGGGCTCCAAACATGG No data
1069809619_1069809629 13 Left 1069809619 10:71148743-71148765 CCTCCCCCTTTAAGGAATGGAGA No data
Right 1069809629 10:71148779-71148801 TGAGAGAAGTTGCCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069809619 Original CRISPR TCTCCATTCCTTAAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr