ID: 1069813611

View in Genome Browser
Species Human (GRCh38)
Location 10:71179854-71179876
Sequence CGGCTGTCTTTGTTCAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069813611_1069813617 30 Left 1069813611 10:71179854-71179876 CCAGGATTGAACAAAGACAGCCG No data
Right 1069813617 10:71179907-71179929 ATACTCCACAGCCAAACATCAGG No data
1069813611_1069813613 -10 Left 1069813611 10:71179854-71179876 CCAGGATTGAACAAAGACAGCCG No data
Right 1069813613 10:71179867-71179889 AAGACAGCCGTGCTCGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069813611 Original CRISPR CGGCTGTCTTTGTTCAATCC TGG (reversed) Intergenic
No off target data available for this crispr