ID: 1069813897

View in Genome Browser
Species Human (GRCh38)
Location 10:71181309-71181331
Sequence CAGTCTCAGCACTCTGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069813897_1069813899 0 Left 1069813897 10:71181309-71181331 CCTCAGACAGAGTGCTGAGACTG No data
Right 1069813899 10:71181332-71181354 GACCATATTTTTGATGAGTTCGG No data
1069813897_1069813900 1 Left 1069813897 10:71181309-71181331 CCTCAGACAGAGTGCTGAGACTG No data
Right 1069813900 10:71181333-71181355 ACCATATTTTTGATGAGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069813897 Original CRISPR CAGTCTCAGCACTCTGTCTG AGG (reversed) Intergenic
No off target data available for this crispr