ID: 1069818664

View in Genome Browser
Species Human (GRCh38)
Location 10:71214251-71214273
Sequence CTTTGGCTATGGAGGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069818664_1069818680 27 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818680 10:71214301-71214323 CACGGCCAGGAGTGAGGGCTTGG No data
1069818664_1069818676 21 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818676 10:71214295-71214317 GATTCCCACGGCCAGGAGTGAGG No data
1069818664_1069818675 14 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818675 10:71214288-71214310 AATTAGTGATTCCCACGGCCAGG No data
1069818664_1069818674 9 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818674 10:71214283-71214305 TCTGGAATTAGTGATTCCCACGG No data
1069818664_1069818671 -9 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818671 10:71214265-71214287 TAGCCAAAGATTCCTCATTCTGG No data
1069818664_1069818677 22 Left 1069818664 10:71214251-71214273 CCTTCCCCCCTCCATAGCCAAAG 0: 1
1: 0
2: 2
3: 22
4: 353
Right 1069818677 10:71214296-71214318 ATTCCCACGGCCAGGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069818664 Original CRISPR CTTTGGCTATGGAGGGGGGA AGG (reversed) Intronic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
901299116 1:8185765-8185787 CTTCGGCTTTGGTGGTGGGAAGG + Intergenic
901900680 1:12359129-12359151 CTTTGCTTATGGAGATGGGAAGG + Intronic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
902860295 1:19240321-19240343 CTTTGGCTCTGGAGACGGAATGG - Exonic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903664958 1:25000671-25000693 CTTTGGCTCTCGAGGGCAGAGGG + Intergenic
905563297 1:38943912-38943934 CATTGGCTAGGGAGTGGGGGTGG + Intergenic
906103232 1:43276390-43276412 ATTTGTCTATGGAGGGGGTTTGG - Intergenic
906557248 1:46723646-46723668 CTATGGCTGAGGTGGGGGGAAGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907678439 1:56540539-56540561 CTTTGCCTATGGCTTGGGGAGGG + Intronic
907757973 1:57329278-57329300 CATGGGCTTTGGAGGGAGGAAGG - Intronic
909316311 1:74223775-74223797 CTCTGCCTATGGAAAGGGGAGGG + Intronic
910391806 1:86753555-86753577 CTTGGGCTTTGGAGTTGGGAAGG - Intergenic
910894370 1:92052428-92052450 CTTTGGCTTTGGAAAGGGGATGG - Intronic
911536472 1:99106195-99106217 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
911574558 1:99559697-99559719 ATTTGGCTTTGGAGCAGGGAAGG - Intergenic
911856365 1:102882136-102882158 CCTTGGCTATGGAGTGAAGATGG - Intronic
911877194 1:103181870-103181892 CTTGGGCTATGGAGGGAGTGCGG - Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912600165 1:110922918-110922940 CTTTGACTATGGAGGAGATAAGG - Intergenic
913245828 1:116869250-116869272 CTATGGATTTGGAGGGGGAAAGG + Intergenic
915234458 1:154470220-154470242 CGTGGGCCATGGAGGGGGCACGG + Intronic
915285235 1:154848093-154848115 CTCTGGCTGGGGAGGGGGGGAGG - Intronic
915924399 1:160004974-160004996 CCTTGGCTGTGGAGGGGGGATGG - Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
918147043 1:181766120-181766142 CTTTGGGTATGGGAGTGGGAGGG + Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
920500276 1:206481056-206481078 CTTGGGCTAATAAGGGGGGATGG + Intronic
921065466 1:211619511-211619533 TTTGGGCTCTGGAGGTGGGAAGG - Intergenic
921072143 1:211669794-211669816 CTCTGGCTATAGAATGGGGAAGG - Intronic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
921960973 1:221034048-221034070 CTTTGGGTATGGGGAGGGGCAGG + Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922872800 1:228916820-228916842 CTTTGGCTAGGGAGGTGGAGGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923531744 1:234817534-234817556 CTTTGATGATGGAGGGTGGAGGG + Intergenic
1063395384 10:5682655-5682677 CTTAGGCTAGGGAAGAGGGATGG + Intergenic
1064908090 10:20369902-20369924 CTTTTCCAATGGAGGGGGCAGGG + Intergenic
1067570124 10:47365431-47365453 CTTTGGCTGTGGAGGGTTGCAGG - Intergenic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070901633 10:80034962-80034984 CTTTGGGTCCGGAGGGGGGCGGG - Intergenic
1072244848 10:93534279-93534301 CTTTGGCTATGGATTTGGGTTGG - Intergenic
1075590119 10:123685054-123685076 CTTTGACTGTGGAGGGGGAAAGG + Intronic
1076394451 10:130128856-130128878 CTTGGGCTAAGGAGAAGGGACGG + Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1076870160 10:133189052-133189074 AATTGGCTTTGGAGTGGGGAGGG + Intronic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077427487 11:2490180-2490202 CTTTGCCTATGGAAAGGAGAAGG + Intronic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1081775965 11:45676109-45676131 CTTGGGCAGTGGAGGAGGGAGGG - Intergenic
1082005316 11:47415856-47415878 CTTTGGCTTAGAAGTGGGGAAGG - Exonic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1083614384 11:64019076-64019098 CTTTGGCTCTGGGTGGGGGCGGG + Intronic
1083660779 11:64250975-64250997 CCTGGGCTAGGGACGGGGGAGGG + Intergenic
1083701618 11:64482943-64482965 CTTTGGTTTTGGGTGGGGGATGG + Intergenic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084426284 11:69086093-69086115 ATGTGGCTATGCAGGGGGCAGGG - Intronic
1084601772 11:70149970-70149992 CTTTGGCCATGGAGGGTGTTCGG - Intronic
1085095612 11:73758518-73758540 CTTCAGTAATGGAGGGGGGAGGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1089625279 11:119747217-119747239 CTTTGAAAATGGAGTGGGGAGGG - Intergenic
1089946581 11:122480078-122480100 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1090168953 11:124581404-124581426 CCTTGGCTCTGGATGGAGGAGGG + Intergenic
1090352253 11:126115054-126115076 CTGGGGCTATGGAGTAGGGAAGG - Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091977394 12:4836394-4836416 CTTTGGCACTGGAGGGGGTCAGG + Intronic
1092350096 12:7749224-7749246 CCTTGGCTCTTGAGGGAGGATGG + Exonic
1096579186 12:52573522-52573544 CTCTGGGTATGGAGGGGGCCGGG - Exonic
1096809939 12:54162802-54162824 CTTTGGCCATGGGGTGGGGAGGG - Intergenic
1096836936 12:54357164-54357186 CTTGGGCTACAGAGAGGGGAAGG - Intergenic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097237340 12:57549502-57549524 CTTTGGATGTGGAAGGGGAAGGG + Intergenic
1097881633 12:64691651-64691673 ACTTGGCTATTGATGGGGGATGG + Intronic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1098789501 12:74803781-74803803 CATTGGCTATAGAAGGGAGAGGG + Intergenic
1100964530 12:99998397-99998419 CTTGGGAGATGGAGGTGGGAGGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103399860 12:120636526-120636548 ATTTGGCGATTGAAGGGGGAGGG - Intergenic
1103587441 12:121966561-121966583 CTTTGGTCATGGATGGGGCATGG - Intronic
1104178515 12:126355719-126355741 CTTGGGCTAGGGATGGGGCATGG + Intergenic
1105450159 13:20492551-20492573 GGCTGGCTATGGAGGGGGAAGGG - Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107568580 13:41632061-41632083 CCTTGGCTATGGAGGTCTGATGG - Intronic
1107619298 13:42209105-42209127 CTTGGGCTAAGGAGGGTTGAAGG + Intronic
1108439572 13:50436947-50436969 CCTTGGGGATGGTGGGGGGAGGG - Intronic
1109555517 13:63969917-63969939 CTTTGGGTAATGAGGGGGAAGGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110714109 13:78682401-78682423 CAATGGCTATGGAGGGTGGGGGG + Intergenic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112618821 13:101034418-101034440 CTTTGCCTTTGGAAAGGGGAAGG - Intergenic
1113391953 13:109906515-109906537 CTTTGACAATGGTGGGGGAAGGG - Intergenic
1113455673 13:110446842-110446864 CTTTTGCTAGGGAAGGGTGAGGG - Exonic
1115000954 14:28419244-28419266 CTTTGTCCATGGAGGGGGATAGG - Intergenic
1117390846 14:55261066-55261088 CTTTGGCTTTGCTGAGGGGAGGG + Intergenic
1118029767 14:61808722-61808744 CCTTAGCCATGGAGAGGGGAAGG + Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119741695 14:77017913-77017935 CTTTAGCTGTGGAGGAGAGATGG + Intergenic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121299717 14:92860888-92860910 CTTGGGCTGAGGTGGGGGGATGG - Intergenic
1121642140 14:95492599-95492621 CTAGGGCTAGGGAGGTGGGAGGG + Intergenic
1121727573 14:96164447-96164469 CTTTGAGGATGGAGGAGGGAGGG + Intergenic
1123071570 14:105644957-105644979 CTTTGGCTTTGGGGCAGGGAGGG - Intergenic
1123076531 14:105670012-105670034 CTTTGGCTTTGGGGCAGGGAGGG - Intergenic
1123833765 15:24167871-24167893 CTTTGTCTCTGGAGCGGGGAAGG + Intergenic
1123840503 15:24242919-24242941 CTTTGTCTCTGGAGCGGGGAAGG + Intergenic
1123853453 15:24383434-24383456 CTTTGTCTCTGGAGCAGGGAAGG + Intergenic
1123869420 15:24556039-24556061 CTTTGTCTCTTGAGTGGGGAAGG + Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1125167977 15:36732131-36732153 TTTTGGCTATAGAGGGGCAAAGG - Intronic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1126079912 15:44949790-44949812 CTTTGACTAGGGGGTGGGGAGGG + Intergenic
1127333795 15:57964136-57964158 CTAGGGCTTTGGAGAGGGGAGGG - Intronic
1128262293 15:66240972-66240994 CTTTGGCTGGGGAGGGGCCACGG - Intronic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129543017 15:76366730-76366752 CTTGGGCTATAGAAGTGGGAGGG - Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137553912 16:49458329-49458351 CATTGGCCGTGGAGTGGGGAGGG - Intergenic
1137721149 16:50628250-50628272 CTTTGACAATGCAGGTGGGAGGG - Intronic
1138011670 16:53386579-53386601 CTTCAGCTAAGGAGGGGGCAGGG - Intergenic
1138394037 16:56690859-56690881 CTTTCTCTATGGAGGGTGGAGGG - Intronic
1138624542 16:58238708-58238730 CTTGGGATATGGAGGGGGCAGGG - Intronic
1139352351 16:66344959-66344981 CTTGGGCTATGGACGAGGTATGG + Intergenic
1140813352 16:78599402-78599424 CTTAGGCTATGGCGGGGGCAGGG - Intronic
1141113075 16:81286357-81286379 CTTGGGGTATGGAGGGGTGGAGG - Intronic
1141642533 16:85349585-85349607 CATTGGCTAGGGAGGGCGGCGGG - Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1142031573 16:87841045-87841067 CTTTGCCTATGGAGGATGGTAGG - Exonic
1143481368 17:7229342-7229364 CTGTGGCTAGGGCGTGGGGAGGG - Intronic
1144344164 17:14334950-14334972 GTTTTGCTTTGGAGTGGGGAGGG + Intronic
1145983446 17:29028011-29028033 ATTTGGCCATGGATGGGGAAAGG + Intronic
1146725119 17:35150031-35150053 CGATGGCTATCGAGGGGAGACGG - Exonic
1146736795 17:35244869-35244891 CTTTTTTTATGGTGGGGGGAGGG - Intronic
1148786326 17:50147949-50147971 CTTTGGCTAGGGAAGGGTAAAGG + Intronic
1149657816 17:58319505-58319527 CCTTGGCTCTGGAGGGGGCTGGG - Intronic
1149660148 17:58330598-58330620 GTTTGGGTATGTAGGGGGGCAGG + Intergenic
1149742817 17:59063810-59063832 CTTTGACTAAGGTGGGGGGCTGG - Intronic
1151537558 17:74747631-74747653 GTTTGGCTAGGGAGGTGGGGTGG - Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152433476 17:80261565-80261587 CTTTGGTTGTGGTTGGGGGATGG + Intronic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1152632675 17:81417556-81417578 CTTTGGCTAGGGCGGGGGGGGGG - Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155760378 18:29558152-29558174 CTTTGGCGATGGGGGTGGGCAGG - Intergenic
1158024936 18:52885392-52885414 CTCTGTCTATGGACAGGGGAGGG - Intronic
1160467167 18:79089092-79089114 CTTTGGCGATGCAGGGGGAAAGG + Intronic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161505287 19:4640348-4640370 CCTTCTCTATGGAGGGGGGAAGG + Intronic
1161697468 19:5777493-5777515 CTCTGGCTAGAGAGGGCGGAAGG - Intronic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165163480 19:33832748-33832770 CTTCCGCTGTGGAGGGGGCATGG - Intergenic
1165186302 19:34025370-34025392 CTTTGGGTTTGGAGATGGGAGGG - Intergenic
1165601483 19:37058533-37058555 CCTAGGCTGTGGAGGGGTGAGGG + Intronic
1167132871 19:47599068-47599090 CCTTGGCTATGCTTGGGGGAGGG - Intergenic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168185927 19:54699209-54699231 CATTTGCTATGGAGGGGGTAGGG + Intronic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
925068708 2:950418-950440 CTTTGGCCAGGGAGGTGGGGCGG + Intergenic
927187843 2:20495030-20495052 CTTTGGCCCTGGAGTGGGGCAGG - Intergenic
927679954 2:25132632-25132654 CCTTGGCTAGGGGGTGGGGATGG - Intronic
929818826 2:45257497-45257519 CTCTGGCTAGGCAAGGGGGAGGG - Intergenic
929926501 2:46216805-46216827 CTCTGGCTTTGGAAAGGGGAGGG - Intergenic
930475511 2:51876210-51876232 CTCTGCCTATGGAAAGGGGAAGG + Intergenic
930685538 2:54303353-54303375 CTTTTTTTTTGGAGGGGGGAGGG - Intronic
930886057 2:56328319-56328341 CTTTGTCTATTGAGGGAGGCTGG + Intronic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
933427398 2:82130140-82130162 CTTTGGTTTTGGAGGTGGGGGGG - Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
934113244 2:88761689-88761711 GATTGGATATGGAGTGGGGAGGG - Intergenic
934717784 2:96553324-96553346 CCTTGGCTCAGGAGGAGGGAGGG + Intergenic
934926892 2:98388448-98388470 CTTCGGCCCTGGAGGGGAGAGGG + Intronic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
936511227 2:113149317-113149339 CTTTGCTTATGGAAAGGGGAGGG - Intergenic
937628388 2:124069249-124069271 CTCTGACTGTGGAAGGGGGAAGG + Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940503727 2:154527117-154527139 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
941407533 2:165109683-165109705 ATCTGGCTATGGAGAGGGGGAGG - Intronic
943731142 2:191305149-191305171 CCTTGTCTAGGGAGGTGGGAGGG + Intronic
944646243 2:201783426-201783448 CCTTGGCCAAGGAGGGTGGAGGG + Intergenic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944786409 2:203075098-203075120 CTTTGGCTTTGGGAGGGGCAGGG + Intronic
945041227 2:205745397-205745419 CTTTGGCTAGAGAGGGGGGAAGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946412115 2:219520595-219520617 CGTTGGCTGTGGAAGGGAGAGGG + Intronic
948945051 2:241215151-241215173 CTTTGGCTGGGGAGGGGGTCTGG + Intronic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1170086902 20:12544209-12544231 CTCTGCCTTTGGAGAGGGGAAGG - Intergenic
1171455323 20:25268159-25268181 TTTTGGATATGGGGGGGGGGCGG - Intronic
1172014647 20:31865831-31865853 ATTTGCTGATGGAGGGGGGAAGG + Intronic
1172201329 20:33128512-33128534 CTTTGGCAATTCAGGGGGAAAGG - Intergenic
1175131588 20:56793698-56793720 CTTTGGCCAGGGTGGGGGCATGG + Intergenic
1175724712 20:61310088-61310110 CATGGGCTTTGGAGGGGGGCAGG - Intronic
1176294200 21:5062073-5062095 CTTTTTATTTGGAGGGGGGATGG - Intergenic
1176933362 21:14840867-14840889 CTTTGGCAATGAAGATGGGATGG + Intergenic
1178127371 21:29529667-29529689 TTTTCCCTATGGAGGAGGGAAGG - Intronic
1179061012 21:37979490-37979512 CCTTGACTAGGGAGGAGGGAAGG + Intronic
1179247349 21:39645358-39645380 CTTTGCCTTTGGAGGGAGGCAGG + Intronic
1179863059 21:44201575-44201597 CTTTTTATTTGGAGGGGGGATGG + Intergenic
1179992960 21:44958201-44958223 CAGTGGCTATGGGGAGGGGAAGG - Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182485205 22:30635198-30635220 CTGGGGCTACGGAGGGGCGATGG + Intergenic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183447754 22:37870069-37870091 CTCTGGCTCTGGATGGGGCAAGG - Intronic
1183698317 22:39435757-39435779 CTTTGGCCATGAAGAGGGGGTGG + Intronic
1183980916 22:41539634-41539656 CGTTGGCTAGGGTGAGGGGATGG - Intronic
1184407521 22:44308498-44308520 CTACGGCTTTGGAGAGGGGAAGG - Intronic
951032180 3:17895144-17895166 CTTTGCCTATGGAAAGGGGAGGG - Intronic
951181981 3:19669303-19669325 CTCTGCCTATGGAGAGGGCAAGG + Intergenic
951241761 3:20294791-20294813 CCTTTGCTATGGAGGAGGAAGGG + Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
951619400 3:24584420-24584442 CTATGGCTGTGTGGGGGGGAGGG + Intergenic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
953040706 3:39252774-39252796 CAATGGCGATGGAGGGGTGAAGG + Intergenic
953290971 3:41662346-41662368 CTTTGGAAATGGATGAGGGAAGG + Intronic
953705677 3:45228059-45228081 CTTTGTCTGTGCAGGGGGGAAGG + Intergenic
954116513 3:48469640-48469662 CTTTGGCTAAGCTGGAGGGATGG - Intronic
955073218 3:55589076-55589098 CCTTGGCTATAGAGGAGGTAAGG + Intronic
955085501 3:55698513-55698535 CTTTGGATATGGCAGGGTGAGGG - Intronic
955479142 3:59371521-59371543 CTATGGCTTTGGAGAGGGGTGGG - Intergenic
956582398 3:70829120-70829142 ATTTGGCCATGGGGGTGGGAGGG + Intergenic
957471844 3:80668565-80668587 CTTCTGCTAGGGCGGGGGGAAGG + Intergenic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
960988861 3:123297507-123297529 CGTTGGATATGGAGGGTGAATGG - Intronic
961952361 3:130762885-130762907 CTTTGCCTATGGAAAGGGAAGGG + Intergenic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964475689 3:157095872-157095894 CTTTTTCTTTGGAGGGGGGGTGG + Intergenic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
966312985 3:178615508-178615530 CTTTGCCTTTGGAAAGGGGAGGG - Intronic
969054162 4:4391132-4391154 CTTTGGCTCTGGTGGGTGGAAGG + Intronic
971220500 4:24701221-24701243 CTTTGGCTATTGCGTGGTGAAGG + Intergenic
971350575 4:25852309-25852331 CATTTGCTATGGCGTGGGGAAGG - Intronic
971565433 4:28133319-28133341 CCTTGACTGTGGAGTGGGGAAGG - Intergenic
972434749 4:39022248-39022270 CTTTGGCTATGGGTGGAGAAAGG - Intronic
972456788 4:39263115-39263137 CTTGGTTTATGGAGGGGGAAGGG + Intronic
975369442 4:73567983-73568005 CTTTGCCTGTGGAAAGGGGAGGG - Intergenic
975477073 4:74835459-74835481 ATTTGGTTATGCAGGGGTGATGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
978197735 4:105990587-105990609 CTTTGCCCCTGGAAGGGGGAGGG + Intronic
979001421 4:115225665-115225687 CTTTGCCCATGGAGAGGAGAGGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
981693385 4:147534108-147534130 CCTTTGCCATGGAGGGGGCAGGG + Intronic
981904424 4:149904473-149904495 TGATGGCTATGGAGGTGGGATGG - Intergenic
983762743 4:171432415-171432437 CTTTGGCCAGGGAAGTGGGACGG - Intergenic
986544391 5:8879842-8879864 CTCTGCCTCTGGAAGGGGGAAGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987695596 5:21325593-21325615 CTTTTGCTATGAAGGGATGATGG - Intergenic
989253385 5:39341186-39341208 CTCTGTCTCTGCAGGGGGGACGG + Exonic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991744807 5:69726505-69726527 CTTTTGCTATGAAGGGATGATGG + Intergenic
991752898 5:69828721-69828743 CTTTTGCTATGAAGGGATGATGG - Intergenic
991796377 5:70306233-70306255 CTTTTGCTATGAAGGGATGATGG + Intergenic
991802516 5:70385455-70385477 CTTTTGCTATGAAGGGATGATGG - Intergenic
991824187 5:70601819-70601841 CTTTTGCTATGAAGGGATGATGG + Intergenic
991832217 5:70703849-70703871 CTTTTGCTATGAAGGGATGATGG - Intergenic
991888755 5:71305789-71305811 CTTTTGCTATGAAGGGATGATGG + Intergenic
991912604 5:71576570-71576592 CTGGGTCTATGGAGGGGGGTAGG - Intergenic
994374405 5:99002822-99002844 GTTTGGCTATAAAGGGGAGAAGG + Intergenic
995077098 5:107998767-107998789 CTTTAGCAATGGAGGATGGATGG - Intronic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997104762 5:131005960-131005982 CTCTGGTTATGGAAAGGGGAGGG + Intergenic
997384226 5:133459852-133459874 CTTTGCCTAGGGAAAGGGGAGGG - Intronic
997469996 5:134112349-134112371 CTTGGGCTGTGGAGAGGGAAGGG - Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998695265 5:144631055-144631077 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
1001429779 5:171650150-171650172 CCTTGGCCATGGTGGTGGGATGG + Intergenic
1001596602 5:172902593-172902615 CTTTGGCTTTGGAGCAGGGGTGG + Intronic
1002086962 5:176781936-176781958 CTCTGGCCATGGCGGTGGGATGG + Intergenic
1004755407 6:18605329-18605351 CATTGGCTGAGGAGGTGGGATGG - Intergenic
1005555187 6:26972473-26972495 CTTTTGCTATGAAGGGATGATGG + Intergenic
1006800474 6:36756579-36756601 CTTTGGCTATACTGGGTGGAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1007344048 6:41214926-41214948 GATTGGCTATGGAGAGGGCAGGG + Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1011034688 6:82960172-82960194 CTTTGCCTATGAAGGAGTGAAGG - Intronic
1011472549 6:87722251-87722273 CTTTGGCGGTGGAGGAGGGGTGG - Intergenic
1012003673 6:93685355-93685377 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013204184 6:107931826-107931848 CTTTGGCTTTGGGGTGGGCAAGG - Intronic
1015143359 6:129959198-129959220 CCTTGGCTATGGAGAGGAGCGGG + Intergenic
1015373659 6:132485189-132485211 GCTTGGTGATGGAGGGGGGAAGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015985594 6:138881358-138881380 CCATGGCTATGAACGGGGGAAGG - Intronic
1016103168 6:140128320-140128342 CTTTGGCTTAGGAGTGGTGAGGG + Intergenic
1016874784 6:148853891-148853913 TTTTGGGTATGCAGGGGGTAGGG - Intronic
1017324458 6:153130421-153130443 CTTTGACTAAGGGGAGGGGAAGG + Intronic
1017362714 6:153594982-153595004 CTTTGGCTCAGGAAGGGGAAAGG - Intergenic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1017802024 6:157905539-157905561 ATTTGGCTATGGGGAGGGGGTGG - Intronic
1018371634 6:163173843-163173865 CTTTGGCTATGGAGAGGACAAGG - Intronic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019587447 7:1813149-1813171 CCCTGGCTGTGGAGGGGGAAGGG + Intergenic
1022531013 7:31066933-31066955 GTTGGGCTATTGAGGGGGCATGG + Intronic
1023215260 7:37855507-37855529 CTTGGGATTTGGTGGGGGGAGGG - Intronic
1024511207 7:50206566-50206588 CATCGGCTGTGGATGGGGGAGGG + Intergenic
1024694433 7:51840190-51840212 GTTTGCCTATGGTAGGGGGATGG + Intergenic
1026159316 7:67854635-67854657 ATTTGGCTCTGGACTGGGGAGGG + Intergenic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1026807263 7:73436133-73436155 CTCTGGCTGGGAAGGGGGGAAGG + Intergenic
1029047298 7:97643899-97643921 CAATGGGCATGGAGGGGGGAAGG + Intergenic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1031231566 7:119114220-119114242 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1037386931 8:18352846-18352868 CTTTGGCAGTGGTGGGGGGCGGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1038405120 8:27315927-27315949 CTTTGCATATGGTGGGGGGGTGG + Intronic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1038980325 8:32752329-32752351 CTGTGGCTATGGGGGAGGGGAGG + Intronic
1042162683 8:65912791-65912813 CTCTGCCTATGGAAAGGGGAGGG + Intergenic
1043941097 8:86196817-86196839 CATTGGCTTTGGGGGTGGGAAGG + Intergenic
1045994972 8:108351967-108351989 CTTTGCCTATGGAAAGGGGAGGG + Intronic
1047725777 8:127682916-127682938 CTTTGGCCATGGTGGGGTGGGGG - Intergenic
1052420254 9:28234344-28234366 CTTTGACTATGTAAAGGGGAAGG + Intronic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1056451471 9:86721427-86721449 CTTTGACTAAGGAGGTGGAAAGG - Intergenic
1059325856 9:113503682-113503704 CTTTGGCCCTGGATGGGGTAGGG + Intronic
1059335808 9:113567717-113567739 CCTGGGCCATGGAGGGTGGAGGG + Intronic
1060384536 9:123212482-123212504 TTTTGGCTAGGGAGGGGCGTTGG - Intronic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060883605 9:127135506-127135528 CTTTGGCAATGGAGGAGCCAGGG + Intronic
1061261374 9:129482651-129482673 TTTGAGTTATGGAGGGGGGAGGG + Intergenic
1061637969 9:131927398-131927420 CTTTGGCTACTCAGGGGAGAAGG - Intronic
1061953809 9:133951179-133951201 CCTTGGCTATGGAGGCAGCAAGG + Intronic
1062049552 9:134440142-134440164 ACTTGGATATGGCGGGGGGAGGG + Intronic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1186506593 X:10098312-10098334 CCCTGGCTGGGGAGGGGGGAGGG - Intronic
1186925883 X:14332972-14332994 ATTTGGCTAAGGAGAAGGGATGG - Intergenic
1187610531 X:20938779-20938801 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1189100828 X:38187773-38187795 ATTTAGCTATGGAGGAGAGAAGG - Intronic
1190046315 X:47113883-47113905 CTTTGCTTATGGAAAGGGGAAGG + Intergenic
1191703805 X:64071273-64071295 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1191888923 X:65920647-65920669 CTTTTGCTATGGTGGGGGTTGGG + Intergenic
1192214345 X:69148049-69148071 CTTTGTTTATGAAGGTGGGATGG + Intergenic
1192268647 X:69557744-69557766 ATTTGGCTTTGCAGTGGGGAGGG - Intergenic
1192539765 X:71957976-71957998 ATCTGGCAATGGTGGGGGGAAGG + Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193099673 X:77594415-77594437 CTTTGACTATGAAAGGTGGAAGG + Intronic
1194706052 X:97177126-97177148 CCATGGATATGGAGGGTGGAGGG + Intronic
1195543283 X:106087334-106087356 CTCTGTCTATGGAAAGGGGAGGG - Intergenic
1195735398 X:108007733-108007755 GTTTGGCTGTGAAGGGGAGAAGG + Intergenic
1195751729 X:108166110-108166132 CTTTGGCCAAAAAGGGGGGAGGG - Intronic
1196226253 X:113170975-113170997 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196865414 X:120066376-120066398 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1196877680 X:120169904-120169926 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1197313074 X:124930158-124930180 ATTTGGCTAGGGAGGTGGGTGGG - Intronic
1198089887 X:133318142-133318164 CTCAAGCTATGGAGTGGGGAAGG - Intronic
1199086410 X:143634527-143634549 CTTGGGGTATGGTGGGGGGGGGG + Intronic
1199704370 X:150411257-150411279 CTTTGGCTGAGGAAGGGGAACGG - Intronic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1201788391 Y:17809558-17809580 CTCTGGCCATGGCGGGGCGAAGG + Intergenic
1201813162 Y:18096430-18096452 CTCTGGCCATGGCGGGGCGAAGG - Intergenic
1202381974 Y:24281196-24281218 CCTTGGCTGAGGAGGGGGCAAGG - Intergenic
1202488810 Y:25388929-25388951 CCTTGGCTGAGGAGGGGGCAAGG + Intergenic