ID: 1069821285 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:71230240-71230262 |
| Sequence | CTGATTGGTCAGAGTGAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069821274_1069821285 | 24 | Left | 1069821274 | 10:71230193-71230215 | CCTAGGGGAACTCAGCTGTGATT | 0: 1 1: 0 2: 1 3: 12 4: 196 |
||
| Right | 1069821285 | 10:71230240-71230262 | CTGATTGGTCAGAGTGAGGAGGG | No data | ||||
| 1069821273_1069821285 | 25 | Left | 1069821273 | 10:71230192-71230214 | CCCTAGGGGAACTCAGCTGTGAT | 0: 1 1: 0 2: 1 3: 13 4: 111 |
||
| Right | 1069821285 | 10:71230240-71230262 | CTGATTGGTCAGAGTGAGGAGGG | No data | ||||
| 1069821279_1069821285 | -7 | Left | 1069821279 | 10:71230224-71230246 | CCTGAGGGCCCTCACTCTGATTG | 0: 1 1: 0 2: 1 3: 8 4: 250 |
||
| Right | 1069821285 | 10:71230240-71230262 | CTGATTGGTCAGAGTGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069821285 | Original CRISPR | CTGATTGGTCAGAGTGAGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||