ID: 1069821285

View in Genome Browser
Species Human (GRCh38)
Location 10:71230240-71230262
Sequence CTGATTGGTCAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069821274_1069821285 24 Left 1069821274 10:71230193-71230215 CCTAGGGGAACTCAGCTGTGATT 0: 1
1: 0
2: 1
3: 12
4: 196
Right 1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG No data
1069821273_1069821285 25 Left 1069821273 10:71230192-71230214 CCCTAGGGGAACTCAGCTGTGAT 0: 1
1: 0
2: 1
3: 13
4: 111
Right 1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG No data
1069821279_1069821285 -7 Left 1069821279 10:71230224-71230246 CCTGAGGGCCCTCACTCTGATTG 0: 1
1: 0
2: 1
3: 8
4: 250
Right 1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069821285 Original CRISPR CTGATTGGTCAGAGTGAGGA GGG Intronic
No off target data available for this crispr