ID: 1069823752

View in Genome Browser
Species Human (GRCh38)
Location 10:71242850-71242872
Sequence CCCTGCCAGCAGCAGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069823742_1069823752 29 Left 1069823742 10:71242798-71242820 CCTGGGTGAGGGAGACGGGGCCA 0: 1
1: 0
2: 2
3: 26
4: 282
Right 1069823752 10:71242850-71242872 CCCTGCCAGCAGCAGGGCACTGG No data
1069823744_1069823752 9 Left 1069823744 10:71242818-71242840 CCACGGTGTCACTCTCTCTGTCC No data
Right 1069823752 10:71242850-71242872 CCCTGCCAGCAGCAGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069823752 Original CRISPR CCCTGCCAGCAGCAGGGCAC TGG Intronic
No off target data available for this crispr