ID: 1069824456

View in Genome Browser
Species Human (GRCh38)
Location 10:71246552-71246574
Sequence TTGGTGAGTGACTGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069824447_1069824456 22 Left 1069824447 10:71246507-71246529 CCTACATATTCAATATCTATTCA 0: 1
1: 0
2: 1
3: 36
4: 439
Right 1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG No data
1069824451_1069824456 -1 Left 1069824451 10:71246530-71246552 CCAACAATCAGTGGGTACAGGAT 0: 1
1: 0
2: 0
3: 13
4: 389
Right 1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069824456 Original CRISPR TTGGTGAGTGACTGGGTTGA GGG Intronic
No off target data available for this crispr