ID: 1069825569

View in Genome Browser
Species Human (GRCh38)
Location 10:71253265-71253287
Sequence CAAGCTACGGGGAAAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069825569_1069825576 -7 Left 1069825569 10:71253265-71253287 CCACCTCCTTTCCCCGTAGCTTG No data
Right 1069825576 10:71253281-71253303 TAGCTTGGTCTTAGTGATGCTGG No data
1069825569_1069825577 9 Left 1069825569 10:71253265-71253287 CCACCTCCTTTCCCCGTAGCTTG No data
Right 1069825577 10:71253297-71253319 ATGCTGGCCACCCTACTGCAAGG No data
1069825569_1069825578 15 Left 1069825569 10:71253265-71253287 CCACCTCCTTTCCCCGTAGCTTG No data
Right 1069825578 10:71253303-71253325 GCCACCCTACTGCAAGGCCCAGG No data
1069825569_1069825582 21 Left 1069825569 10:71253265-71253287 CCACCTCCTTTCCCCGTAGCTTG No data
Right 1069825582 10:71253309-71253331 CTACTGCAAGGCCCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069825569 Original CRISPR CAAGCTACGGGGAAAGGAGG TGG (reversed) Intronic
No off target data available for this crispr