ID: 1069826316

View in Genome Browser
Species Human (GRCh38)
Location 10:71257144-71257166
Sequence GAGCCAGCAGGTGCTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069826303_1069826316 12 Left 1069826303 10:71257109-71257131 CCTGGAAACCCACAGCCCCACTG 0: 1
1: 0
2: 7
3: 39
4: 347
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data
1069826306_1069826316 4 Left 1069826306 10:71257117-71257139 CCCACAGCCCCACTGGGTTCCCT 0: 1
1: 0
2: 4
3: 35
4: 328
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data
1069826307_1069826316 3 Left 1069826307 10:71257118-71257140 CCACAGCCCCACTGGGTTCCCTC 0: 1
1: 0
2: 7
3: 51
4: 481
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data
1069826308_1069826316 -3 Left 1069826308 10:71257124-71257146 CCCCACTGGGTTCCCTCTGTGAG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data
1069826309_1069826316 -4 Left 1069826309 10:71257125-71257147 CCCACTGGGTTCCCTCTGTGAGC 0: 1
1: 0
2: 0
3: 19
4: 165
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data
1069826310_1069826316 -5 Left 1069826310 10:71257126-71257148 CCACTGGGTTCCCTCTGTGAGCC 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069826316 Original CRISPR GAGCCAGCAGGTGCTTCCTG GGG Intronic
No off target data available for this crispr