ID: 1069827389

View in Genome Browser
Species Human (GRCh38)
Location 10:71262479-71262501
Sequence TTCTCCCCAAGGAAGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069827389_1069827394 1 Left 1069827389 10:71262479-71262501 CCAGGCCACTTCCTTGGGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1069827394 10:71262503-71262525 AGGACCCAGAGGAGCCCGCCCGG No data
1069827389_1069827402 27 Left 1069827389 10:71262479-71262501 CCAGGCCACTTCCTTGGGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1069827402 10:71262529-71262551 ACTCATTCATTCATGCACGAAGG No data
1069827389_1069827393 -10 Left 1069827389 10:71262479-71262501 CCAGGCCACTTCCTTGGGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1069827393 10:71262492-71262514 TTGGGGAGAACAGGACCCAGAGG No data
1069827389_1069827395 2 Left 1069827389 10:71262479-71262501 CCAGGCCACTTCCTTGGGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069827389 Original CRISPR TTCTCCCCAAGGAAGTGGCC TGG (reversed) Intronic
900890219 1:5444187-5444209 TACTCCCCTAGTTAGTGGCCTGG - Intergenic
901686914 1:10948221-10948243 GTCTCCCCAGGGAGGGGGCCAGG - Exonic
902837865 1:19058375-19058397 CTCTTCCCAAGGCAGTGGGCAGG - Intergenic
903294657 1:22336094-22336116 TTCTGCCAAAGGAAGTGGACAGG + Intergenic
904002195 1:27345204-27345226 TTCTCCCCAAACACTTGGCCGGG - Exonic
904377311 1:30090021-30090043 TTTTAAGCAAGGAAGTGGCCTGG + Intergenic
904684728 1:32251746-32251768 TTCTCAGCAAGGCAGTGGCAGGG + Intronic
908038357 1:60080702-60080724 TTATCCCCCAGCATGTGGCCTGG - Intergenic
908740301 1:67320656-67320678 TTCTTCCTAAGAAAGTGGCTTGG + Intronic
909101727 1:71357405-71357427 GTCTCCCCCAGGAACAGGCCCGG + Intergenic
913665509 1:121044602-121044624 TTCTCCCCATATTAGTGGCCAGG - Intergenic
914016905 1:143827873-143827895 TTCTCCCCATATTAGTGGCCAGG - Intergenic
914160881 1:145133137-145133159 TTCTCCCCATATTAGTGGCCAGG + Intergenic
914655514 1:149736412-149736434 TTCTCCCCATATTAGTGGCCAGG - Intergenic
916785740 1:168085839-168085861 TTGTCCCCAAGGTAGTCCCCAGG - Intronic
918145717 1:181753932-181753954 ATGCTCCCAAGGAAGTGGCCTGG + Intronic
919791313 1:201292609-201292631 TGCTCCCCCAGGCAATGGCCGGG + Intronic
919972338 1:202589354-202589376 CTCTCCCCAAGTCAGTGACCAGG - Exonic
924301707 1:242645933-242645955 TTCTCCCCACAGAAGTGGTGGGG - Intergenic
1062925163 10:1310781-1310803 GTTTCCCCAAGGAAGAGGCAGGG + Intronic
1062955639 10:1538639-1538661 TTCTGCCCATGGACGTGGCCTGG + Intronic
1065188021 10:23188087-23188109 TTCTCCCCACTTGAGTGGCCAGG - Intergenic
1068885679 10:62094376-62094398 TTATCCCCAAAGATGTGGCCTGG - Exonic
1069072853 10:64007412-64007434 TTCTCACCAAGGAACAGCCCTGG - Intergenic
1069598150 10:69686190-69686212 GTCTCCTCAAGGAAGTGGCAGGG - Intronic
1069827389 10:71262479-71262501 TTCTCCCCAAGGAAGTGGCCTGG - Intronic
1075210582 10:120487752-120487774 TTCTCACTAAGGAACTGGACTGG - Intronic
1077233584 11:1469378-1469400 TGCCCACCAAGCAAGTGGCCGGG + Intergenic
1077462378 11:2717068-2717090 TTGTCCACCATGAAGTGGCCGGG + Intronic
1078604945 11:12766938-12766960 TCCTCCCCAAGGCAGCTGCCTGG - Intronic
1078851821 11:15171217-15171239 TGCTCCCCAAGGAAGAGCTCTGG - Intronic
1079130054 11:17741947-17741969 TTCTCTCCCAGGAAGGGCCCTGG - Intronic
1080558359 11:33438185-33438207 TTCTCCCCCAAGAAATGACCAGG - Intergenic
1082992591 11:59220833-59220855 CTCTCTCCCAGGAAGAGGCCTGG + Intergenic
1083824991 11:65195853-65195875 TTCTCACCAAAGAAATGTCCAGG - Intronic
1084770605 11:71340620-71340642 TTCTCCCTATGACAGTGGCCCGG - Intergenic
1087742298 11:101901894-101901916 TTCTGCACAAAGAAGTGCCCAGG + Intronic
1089299600 11:117490608-117490630 TTCTTACTAAGGAGGTGGCCTGG + Intronic
1091975207 12:4819277-4819299 TTCTTCCCAAGGAAGAAGGCAGG - Intronic
1092919104 12:13214858-13214880 TTCTCCCCAGGGCAGGGGCTTGG - Exonic
1094347935 12:29491522-29491544 ATCTCTCAAAGGCAGTGGCCTGG - Intronic
1096367497 12:51040984-51041006 TTCTTCCCAAGGAACTGGGGGGG - Intergenic
1096555231 12:52399792-52399814 TGCTCTGCAGGGAAGTGGCCTGG + Intronic
1096787601 12:54026501-54026523 TTCTCCCCAAGGAAATGAAGGGG - Intronic
1097106449 12:56629181-56629203 GCCTCCCGCAGGAAGTGGCCGGG - Intronic
1098416884 12:70243875-70243897 TTCTCCCCCAGGAAGCAGCGCGG - Intronic
1098627421 12:72689538-72689560 TTCTCCCCAAAAATGTAGCCAGG - Intergenic
1099724428 12:86408027-86408049 ATCTATCCAAGGAAGTTGCCTGG - Intronic
1102313487 12:111866047-111866069 TTCTCATCAAGGATATGGCCAGG - Intronic
1102584069 12:113910949-113910971 GTCTCCACCAGGAAGTGCCCAGG - Intronic
1105546767 13:21356327-21356349 TTAGCCACAAGGAACTGGCCAGG + Intergenic
1106581341 13:31021092-31021114 TTCTCCAGAAAGAAGTGGGCTGG - Intergenic
1110463199 13:75770187-75770209 TTTTCCCCACCGAAGGGGCCTGG + Intronic
1113811336 13:113144281-113144303 AGCTCCACAGGGAAGTGGCCGGG + Intronic
1114974662 14:28079596-28079618 TTCTCACCAAACAAGTGGTCAGG - Intergenic
1118435913 14:65770792-65770814 TTCTCTCCAAGCAGGTGACCAGG - Intergenic
1122077875 14:99247167-99247189 TTCTCCCCAAAGCAAAGGCCAGG + Intronic
1122629316 14:103100043-103100065 CTCTCGCCAAGAGAGTGGCCTGG + Intergenic
1122654006 14:103244811-103244833 TTCTCTCCAAGCAGGCGGCCTGG - Intergenic
1122903776 14:104792709-104792731 TTCTCCCAGAGGCTGTGGCCAGG - Exonic
1127121658 15:55777221-55777243 CTCTCACAAAGGAAGTGGCTGGG + Intergenic
1131067739 15:89444692-89444714 TCCTACCCCAGGAAGGGGCCTGG - Intergenic
1132458696 16:38646-38668 TGCTCCCCTAGGGAGTGTCCTGG - Intergenic
1134682072 16:16133209-16133231 TTGTCCCCCAGCAAATGGCCAGG - Intronic
1135277413 16:21125527-21125549 TTCTTCCCAAGAAAGAGGCATGG - Intronic
1135929429 16:26724286-26724308 TGCTCCCCCAGGAAGGGGGCTGG + Intergenic
1138243154 16:55445383-55445405 CTCTCCCTAGGGATGTGGCCTGG + Intronic
1138536089 16:57660982-57661004 GTCTCCTCGAGGAATTGGCCTGG + Intronic
1139692526 16:68650275-68650297 TTTTCCCCAAGGAATGGGGCAGG - Intronic
1143330535 17:6131749-6131771 TTCTGATCAAGGAAGTTGCCTGG + Intergenic
1143522854 17:7455367-7455389 TTCTTCTCCAGGAAGTGGCTGGG + Exonic
1143965371 17:10753111-10753133 TTTTCCCCAAGGGGCTGGCCAGG + Intergenic
1144437465 17:15254587-15254609 ATATCCCAAGGGAAGTGGCCAGG + Intronic
1144494706 17:15738891-15738913 TTGTCCCCAGGGCAGAGGCCAGG + Intronic
1144905550 17:18637781-18637803 TTGTCCCCAGGGCAGAGGCCAGG - Intronic
1146534713 17:33640071-33640093 TTATCCTCAAGAAAGAGGCCAGG - Intronic
1147042074 17:37726969-37726991 TCCTCCTCAAGGTAGTGGCCAGG + Intronic
1147685445 17:42284179-42284201 TTCTCCCCAGGGTAGGGGCATGG + Intergenic
1148021706 17:44557752-44557774 TTCTCCCCGTGGAACTGGGCCGG - Exonic
1148786343 17:50148006-50148028 TCCGCCCCATGGAAGTGTCCAGG - Intronic
1151886437 17:76925724-76925746 TTTCCCCCAGGGAAGAGGCCCGG - Intronic
1152785154 17:82243945-82243967 TTCTTCCCCAGGAGGTGGGCAGG - Exonic
1154122101 18:11660438-11660460 TCCTTCTCAAGGAACTGGCCTGG + Intergenic
1159711735 18:71767911-71767933 TTCTTCCCTAGGCAATGGCCTGG - Intronic
1160043961 18:75369887-75369909 TGGTCCCCATGGAAGTGGGCTGG - Intergenic
1160673141 19:375758-375780 TTCCCCCCGAGGAGGTGGCCGGG - Exonic
1162734835 19:12740882-12740904 TTCTCACCAAGGAACAGGCAAGG + Intronic
1164314611 19:24075886-24075908 TTCTCAGCAAGGAACAGGCCTGG - Intronic
1164848153 19:31452107-31452129 TTCTTCCCAAGGTAGTGGACCGG + Intergenic
1165686230 19:37822847-37822869 TTTTCCCCAAAGAAGTGGTTTGG + Intergenic
1166837205 19:45674782-45674804 TGGTCCCCAAGGTAGGGGCCAGG - Exonic
1167030132 19:46953375-46953397 TTCTTCCCCAGGAAATGGCATGG - Intronic
925156528 2:1652491-1652513 TTCTCCCCAAGAATGTGCCTGGG + Intronic
926429072 2:12767485-12767507 TTCTCTTCAAGGAAGTGGAGTGG - Intergenic
931114760 2:59152643-59152665 TTTTCCACACTGAAGTGGCCTGG + Intergenic
934717881 2:96553727-96553749 TGCTCCTGAAGGAGGTGGCCAGG - Intergenic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937642568 2:124230165-124230187 TACTGCCCAAGGAAGTGGTATGG - Intronic
939636891 2:144593014-144593036 TTCTCCTCCAGGAAATGTCCTGG + Intergenic
941684345 2:168432840-168432862 TGCTAACCAAGAAAGTGGCCGGG + Intergenic
942703879 2:178746463-178746485 TTCTCCTCAAGAAATTGTCCTGG - Intronic
946121632 2:217520923-217520945 TTCTTCACAAGGAAGGGGCTTGG - Intronic
946398548 2:219456065-219456087 ATCTCACCAAGTAGGTGGCCTGG - Intronic
946409232 2:219508179-219508201 ATCACCCCAAGGAAGGGGCTGGG + Intergenic
948758293 2:240172266-240172288 GACTACCCAAGGAAGTGGCCAGG - Intergenic
1169404779 20:5314459-5314481 CTCTCCCCAAGGATGTGGGCAGG - Intergenic
1175659908 20:60803679-60803701 TGCTCCCCAAGGCAGGGGTCAGG - Intergenic
1176025249 20:62982307-62982329 TCCTCCCCAAGCTTGTGGCCTGG - Intergenic
1177075347 21:16564459-16564481 TTCTGACAAAGGAAGTGGACGGG + Intergenic
1180731200 22:17983780-17983802 TTCTTCCATAGGAAGTGGCATGG - Intronic
1182623055 22:31628266-31628288 TGCTGGCCAAGGAAGTGGCTTGG - Intronic
1184417162 22:44359139-44359161 GTCTCCCCAGGGACGTGGCAGGG + Intergenic
949693253 3:6664787-6664809 TTCCCCCTAAGGATGTGCCCTGG + Intergenic
950416000 3:12869320-12869342 TGCTCCGCGGGGAAGTGGCCCGG - Intronic
952205883 3:31181303-31181325 TTTTCCCCAAGGAATGGGGCAGG - Intergenic
953168044 3:40482660-40482682 CTCTCCCCCAGCAAGTGTCCAGG - Exonic
954415173 3:50389873-50389895 TTCTTACCAAGGAAGGGGCATGG - Intronic
960195925 3:114767907-114767929 TTCTCTCCAAGGAAGGGGTGGGG + Intronic
960906002 3:122602221-122602243 GTCTCCCAAAGGCAGTGCCCTGG - Intronic
961002181 3:123381403-123381425 CTCTCCCCAAAGACGTGGCTGGG + Intronic
963857669 3:150271982-150272004 TTCTCCCAAAGTTGGTGGCCCGG + Intergenic
969259092 4:6022400-6022422 TTCTACCTGAGGAAGTGACCTGG + Intergenic
969468195 4:7370155-7370177 GTCTCCCCCAGGAAGAGCCCAGG - Intronic
969515011 4:7642245-7642267 CCATCCCCAAGGAAGGGGCCAGG - Intronic
971143799 4:23953578-23953600 ATATCCCCAGGGAAGTAGCCAGG + Intergenic
972615173 4:40691124-40691146 TTGCCCCGAAGGAAGGGGCCAGG + Intergenic
973060953 4:45723590-45723612 CTCTCAGCAAGGAAATGGCCAGG + Intergenic
981391141 4:144193209-144193231 TTCTCCTCTAGGCACTGGCCAGG + Intergenic
981546916 4:145903039-145903061 TGCTTCCCAAGGAGGTGTCCGGG + Exonic
982515172 4:156337181-156337203 TGCTCCCCAAAGAAGTAGGCAGG - Intergenic
985127831 4:186712945-186712967 TTCTCTCCCAGGATGTGCCCCGG - Intronic
985493154 5:190907-190929 TTCTCCCCAAGGACCCGGCGGGG - Intergenic
985771621 5:1815342-1815364 TTCTCCCCAAAGCAGAGTCCTGG + Intronic
985947684 5:3199746-3199768 TTGTCCTCCAGGAAGTGACCAGG + Intergenic
986396075 5:7332101-7332123 ATATCTTCAAGGAAGTGGCCAGG + Intergenic
986534721 5:8775319-8775341 TTCTCCAGAAGGAACAGGCCAGG + Intergenic
986597594 5:9439798-9439820 TTTTCCACAAGGAAGGGGCTGGG - Intronic
989551652 5:42742737-42742759 ATCTCCCAAAGGGAGTTGCCTGG - Intergenic
990450495 5:55928270-55928292 TCCTCCCCAGGCAAGGGGCCTGG + Intergenic
990528834 5:56654162-56654184 TTTTAAGCAAGGAAGTGGCCTGG - Intergenic
991003368 5:61804899-61804921 TTCTCCCCCATGAAGAGGCCAGG + Intergenic
997206020 5:132050661-132050683 AGCTCCCCAAAGAAGTGCCCTGG + Intergenic
998003224 5:138640620-138640642 TTCTGCCCCAGGAAGTGGATAGG + Intronic
998396772 5:141823778-141823800 CTCTCTCCAAGGAAGCGGCTGGG + Intergenic
1000829703 5:166087391-166087413 TTGTCTTCAAGGAAGTGACCCGG + Intergenic
1001853412 5:174989447-174989469 TTCTCCCAAAAGCAGTGGCAGGG - Intergenic
1002318277 5:178359760-178359782 TTCCCTTCAAAGAAGTGGCCTGG - Intronic
1003404920 6:5820469-5820491 TTAGCCACAAGGAACTGGCCAGG - Intergenic
1003423835 6:5983272-5983294 TTCTCCCCCAGGAAGCTGACGGG - Intergenic
1003873400 6:10418453-10418475 TTCGCCCCAACCAAGAGGCCTGG - Intronic
1004565754 6:16795768-16795790 TTCCCCCCAAAGAAGTCTCCTGG + Intergenic
1004656245 6:17664755-17664777 ATCTGACCAAGGTAGTGGCCAGG + Intronic
1007324928 6:41052800-41052822 TTCCCCCAAAGCAAATGGCCTGG + Intronic
1007731013 6:43946457-43946479 TTTTCCCCACAGAAGTGGCAAGG + Intergenic
1009723116 6:67501733-67501755 TTCTCCTCAGGGAATTTGCCAGG - Intergenic
1011191700 6:84736843-84736865 TTCTTCCCAAGGAAGTTTCTTGG - Exonic
1013451226 6:110283283-110283305 TTCTCCCCAAAGAAAAGGCAGGG + Intronic
1015024815 6:128520246-128520268 TTCTCCGCAGGTGAGTGGCCGGG - Exonic
1017207596 6:151820251-151820273 TTCTGTCCAAGGAACTGGGCTGG - Intronic
1019113852 6:169740772-169740794 TCCTCCACAAAGAAGTGGGCTGG - Intronic
1019780304 7:2935864-2935886 TGCCCAGCAAGGAAGTGGCCAGG + Intronic
1019995505 7:4721999-4722021 TTCTCCCAAAGGAGGCAGCCGGG + Intronic
1022494293 7:30843602-30843624 TCCACCCCATGGATGTGGCCTGG - Intronic
1023378528 7:39582784-39582806 TTGTCTCCAAGGAAGTAACCAGG + Intronic
1025825666 7:65008480-65008502 TCCTCACCAAGGGAGTGGGCAGG + Intergenic
1025898675 7:65726296-65726318 TCCTCACCAAGGGAGTGGGCAGG + Intergenic
1027487970 7:78785887-78785909 GTCTCACCAAGGAAGTGTCCAGG - Intronic
1029573454 7:101386977-101386999 TGCTCCCCAGGGGCGTGGCCAGG - Intronic
1029740403 7:102488495-102488517 TTGTCCCCACGGAAGACGCCAGG + Exonic
1029758399 7:102587667-102587689 TTGTCCCCACGGAAGACGCCAGG + Exonic
1029776337 7:102686746-102686768 TTGTCCCCACGGAAGACGCCAGG + Intergenic
1032090672 7:128910158-128910180 TGGTCCCCAAGGAATTGTCCCGG + Intronic
1036101308 8:5788788-5788810 GTCTCCACAAGGAAGTGGGCAGG + Intergenic
1036786943 8:11694049-11694071 TTTTCCCCAAGGAGGTGCCGTGG + Intronic
1038049705 8:23797143-23797165 TTCCTCCCAAGCAGGTGGCCAGG + Intergenic
1039397441 8:37238650-37238672 TTCTCCCGAAAGAAGTGGCAGGG - Intergenic
1040616799 8:49045858-49045880 TTCTCCCAAAGGCAGTAGCTTGG - Intergenic
1041520069 8:58746147-58746169 TTCTCTCCAGGAAAGTGGACTGG + Intergenic
1044692519 8:94894885-94894907 TTCTCCCCATGGAGGGGACCCGG + Intronic
1047061196 8:121228050-121228072 TTATACCCAAGGAAGAGGCACGG - Intergenic
1048386452 8:133917089-133917111 TTCTCTCCAAGGCAGTAGCTTGG - Intergenic
1050719274 9:8566866-8566888 ATCTACCCAAGGCAGTGTCCAGG - Intronic
1051751439 9:20346191-20346213 TTCTCTCCAAGGAAATCCCCGGG - Exonic
1055084401 9:72299431-72299453 TTCTCCCCACTGGAGGGGCCTGG + Intergenic
1059389767 9:113991720-113991742 TTCTCCCCTGGGAACTGGACTGG + Intronic
1060203505 9:121667370-121667392 TGCTCCCCGAGGGAGGGGCCAGG - Intronic
1061330662 9:129890340-129890362 TTGTCCCCCACGAGGTGGCCCGG + Exonic
1061465105 9:130772081-130772103 TTCTCCCTAAGGCAGTTACCAGG - Intronic
1061731120 9:132614787-132614809 TTCTCCCCAGACAACTGGCCAGG + Intronic
1061874161 9:133535603-133535625 TTCTTCCCCTGGAATTGGCCAGG + Intronic
1186473348 X:9837979-9838001 TGCTTCCCAAGGAAATGTCCAGG - Intronic
1186973143 X:14872092-14872114 TTCTGGACAAGGAAGTGTCCAGG + Intronic
1187724963 X:22192721-22192743 GCCTCCCTAAGGAGGTGGCCTGG - Intronic
1195496658 X:105543155-105543177 ATGTTTCCAAGGAAGTGGCCTGG + Intronic
1199601214 X:149542252-149542274 TTATCCCGATGGAAGTGGCCAGG + Intronic
1199649163 X:149937232-149937254 TTATCCCGATGGAAGTGGCCAGG - Intronic
1200009325 X:153109296-153109318 TTTTCAGCAAGGAAGTGACCCGG - Intergenic
1200030275 X:153290626-153290648 TTTTCAGCAAGGAAGTGACCCGG + Intergenic