ID: 1069827391

View in Genome Browser
Species Human (GRCh38)
Location 10:71262484-71262506
Sequence TCCTGTTCTCCCCAAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069827391_1069827402 22 Left 1069827391 10:71262484-71262506 CCACTTCCTTGGGGAGAACAGGA 0: 1
1: 0
2: 1
3: 22
4: 240
Right 1069827402 10:71262529-71262551 ACTCATTCATTCATGCACGAAGG No data
1069827391_1069827395 -3 Left 1069827391 10:71262484-71262506 CCACTTCCTTGGGGAGAACAGGA 0: 1
1: 0
2: 1
3: 22
4: 240
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data
1069827391_1069827394 -4 Left 1069827391 10:71262484-71262506 CCACTTCCTTGGGGAGAACAGGA 0: 1
1: 0
2: 1
3: 22
4: 240
Right 1069827394 10:71262503-71262525 AGGACCCAGAGGAGCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069827391 Original CRISPR TCCTGTTCTCCCCAAGGAAG TGG (reversed) Intronic
900438081 1:2640942-2640964 CCCTGTCCTTCCCAAGGCAGAGG + Intronic
901686916 1:10948226-10948248 GCCTGGTCTCCCCAGGGAGGGGG - Exonic
902183726 1:14709733-14709755 TCCTGTCCTCCCCATCTAAGGGG + Intronic
902998220 1:20244308-20244330 TCCTGATCTGCCCAAGGCTGAGG + Intergenic
903125428 1:21244425-21244447 CCACCTTCTCCCCAAGGAAGTGG - Intronic
903329135 1:22588281-22588303 TCCTGGTCTCCTCAACCAAGGGG + Intronic
907442417 1:54487543-54487565 GCCTGTACTCCTCATGGAAGTGG + Intergenic
907664027 1:56418458-56418480 TCCTGTTTCCCCTGAGGAAGTGG + Intergenic
908849986 1:68366156-68366178 TCCTGTGCTCCCCTAGGGAGCGG - Intergenic
908916145 1:69128986-69129008 TGCTGTGTTCCCCAGGGAAGTGG + Intergenic
910724752 1:90327149-90327171 TTCTGCTGTCCCCCAGGAAGGGG - Intergenic
911109027 1:94163704-94163726 TGCTGATCACCCCAAGGAATGGG + Intronic
911556163 1:99347342-99347364 TCCTGTTCCACCAAAGGCAGGGG - Intergenic
912768503 1:112439189-112439211 TCCTGCTCTCACCATGGTAGGGG + Intronic
915112321 1:153571961-153571983 TCTCCTTCTCCCAAAGGAAGAGG + Intergenic
915360863 1:155285608-155285630 TCATGTTCTGCCAAAGGATGGGG - Intronic
915738958 1:158103526-158103548 TCCTGATGTCTCTAAGGAAGAGG - Intergenic
916499682 1:165376163-165376185 TCCTGCTCTCCCCGAGCACGCGG + Intergenic
921258348 1:213362841-213362863 TACTGACCTCCCCAAGCAAGAGG + Intergenic
922593645 1:226797629-226797651 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593651 1:226797668-226797690 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593658 1:226797707-226797729 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593665 1:226797746-226797768 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593684 1:226797860-226797882 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593697 1:226797935-226797957 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593704 1:226797974-226797996 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593711 1:226798013-226798035 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593718 1:226798052-226798074 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593725 1:226798091-226798113 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593744 1:226798205-226798227 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593757 1:226798280-226798302 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593764 1:226798319-226798341 TCCTGATCTTCACAAGGAGGAGG + Intergenic
922593771 1:226798358-226798380 TCCTGATCTTCACAAGGAGGAGG + Intergenic
1066801949 10:39202622-39202644 TTCTCTTGGCCCCAAGGAAGGGG + Intergenic
1068635748 10:59346471-59346493 AGCTGGTCTCCCCAAGGAAGTGG + Intronic
1069348273 10:67495599-67495621 TCCTCTTCTCCCCAAGTTGGAGG + Intronic
1069539219 10:69281049-69281071 TCATGTCCTCCACATGGAAGAGG - Intronic
1069546554 10:69333447-69333469 TTCTGTTCTCCCCGAGGGAATGG + Intronic
1069598152 10:69686195-69686217 TTCAGGTCTCCTCAAGGAAGTGG - Intronic
1069827391 10:71262484-71262506 TCCTGTTCTCCCCAAGGAAGTGG - Intronic
1069853579 10:71426071-71426093 TCCTGCCCTCCCCAAGACAGAGG - Intronic
1070972844 10:80581759-80581781 TCCTTATCTGCACAAGGAAGTGG + Intronic
1071056654 10:81519447-81519469 TGCATTTCTCCCCAAGGATGTGG - Intergenic
1071178433 10:82954850-82954872 TTCTGTTCTCCCCAAGGTTTTGG - Intronic
1072473763 10:95738431-95738453 TCCTGATCTGGCCAAGCAAGGGG - Intronic
1072872020 10:99130578-99130600 TTCTCTTGGCCCCAAGGAAGGGG + Intronic
1073033685 10:100548187-100548209 TCCTGTCCTCATCAATGAAGCGG - Exonic
1074596898 10:114876217-114876239 TTCTGTTCTCCCTGAGGAAAGGG - Intronic
1075341168 10:121647939-121647961 CCCTGGTCTCCCCCAGAAAGAGG + Intergenic
1076483434 10:130800167-130800189 TCCTGTTCTCTCCAGAGGAGTGG - Intergenic
1076918523 10:133439308-133439330 TCCTGTTGTCCTCCAGGAAAGGG + Intergenic
1079884568 11:25971097-25971119 TTCTATTTTCCCTAAGGAAGAGG + Intergenic
1081656922 11:44863448-44863470 TCCTCTTCTTCCCTGGGAAGGGG + Intronic
1081907188 11:46677545-46677567 CCCTGTACTCCCCAAGGACAAGG + Exonic
1083299916 11:61734942-61734964 TCATGTTCTCGTCCAGGAAGTGG - Exonic
1089194613 11:116686922-116686944 TCCACTTCTCCCCGAGGACGGGG - Intergenic
1089323081 11:117639615-117639637 TCCTCTTCACTCCAAGGATGGGG - Intronic
1090082794 11:123625506-123625528 TCCTCTTGTCCCCAAAGAGGTGG - Intronic
1091699369 12:2650076-2650098 TCCCGTTCCCCTCAAGGCAGGGG - Intronic
1093097581 12:14989512-14989534 TCCTTCTCTGCCCAGGGAAGTGG + Intergenic
1093228044 12:16509253-16509275 TTCTTTTCTCCCCATGGAAGGGG - Intronic
1098835787 12:75422726-75422748 TTTTGTTCTCCCCTAGGAAACGG - Intronic
1102518726 12:113466271-113466293 TCCTGTTCTTCCCAGGGCTGAGG - Intronic
1102733452 12:115135846-115135868 TTCTGTTCTCACTAAGGATGTGG + Intergenic
1103066034 12:117898277-117898299 TCCTGTTTTCCTAAAGAAAGTGG - Intronic
1103520870 12:121536524-121536546 TCCTCTTCTCTCTAAGGAAAGGG + Intronic
1105532277 13:21230735-21230757 TCCTGTGCTCCCCTAGGCGGTGG - Intergenic
1105778061 13:23680968-23680990 TGCTGTCCTCCCCAAGCCAGGGG - Intergenic
1106219120 13:27730352-27730374 TGATTTTCTTCCCAAGGAAGTGG + Intergenic
1108425131 13:50291809-50291831 TCATGTTATCACCAAGGAAATGG + Intronic
1109735289 13:66476049-66476071 CCCAGTTCTCACCAAGGAAGGGG - Intronic
1113402128 13:110004029-110004051 GGCCGATCTCCCCAAGGAAGAGG + Intergenic
1113929032 13:113956791-113956813 TCCCGTACTCCACCAGGAAGAGG - Intergenic
1116160173 14:41257913-41257935 TCCCTTTCTCCCCCAGGATGTGG + Intergenic
1117105603 14:52394661-52394683 TCCTAGTCCCCCAAAGGAAGGGG - Intergenic
1117489946 14:56236730-56236752 TCCAGTGCTCCCCAGGGAAGGGG - Intronic
1118426536 14:65670143-65670165 TTCCTTTCTCTCCAAGGAAGTGG + Intronic
1118910202 14:70055788-70055810 TCCTGTTATCTCCAGGTAAGAGG - Exonic
1118917620 14:70121206-70121228 ACCTGATCTCTTCAAGGAAGGGG - Intronic
1119342745 14:73894361-73894383 TCCTCTTCTCTCCATGGAACAGG - Exonic
1121343860 14:93120880-93120902 TCCTGTTCCACCCAAGGCAGGGG - Intergenic
1121657127 14:95605316-95605338 TCCTGCTCTCCGCAAGGGACAGG - Intergenic
1121662163 14:95643375-95643397 ACCTGTTCTCACCAAGTAAGTGG + Intergenic
1122266249 14:100548302-100548324 ACCTGTCCTCCCCAGGGAGGTGG + Intronic
1122277999 14:100605104-100605126 TCCTGGTCTCCACAGGGAGGAGG + Intergenic
1122827402 14:104376922-104376944 CACTGTTCTCCCCGAGGCAGCGG + Intergenic
1122940045 14:104977181-104977203 ACCTGTTTTCCCCAAGGAGTGGG + Intronic
1125149989 15:36520561-36520583 TCCTGTTGTCCCTGAGGGAGAGG - Intergenic
1126413599 15:48396016-48396038 GCCTGTTCTCCCCAAGACTGAGG - Intergenic
1128247047 15:66140247-66140269 TCCTTTCCTGCCCAGGGAAGTGG - Intronic
1128713547 15:69890152-69890174 AGCTGTTTTCCCAAAGGAAGTGG - Intergenic
1130233487 15:82114038-82114060 TCCTGTGCCCCTTAAGGAAGGGG - Intergenic
1132567476 16:630128-630150 CCCTGCCCTCCCCAACGAAGAGG + Intronic
1133565785 16:6992084-6992106 ACCCGTTCTCCCTAAGGAATGGG - Intronic
1133847889 16:9474047-9474069 TCCTATTCTCCCACAGGAATTGG + Intergenic
1133861377 16:9598604-9598626 TCCTGTGGGCCACAAGGAAGGGG - Intergenic
1134869142 16:17635857-17635879 TCCTTTTCTCTCCTTGGAAGGGG - Intergenic
1135929427 16:26724281-26724303 GCGTGTGCTCCCCCAGGAAGGGG + Intergenic
1136520601 16:30793454-30793476 TCATCTTCTTCCCAAGGAAGAGG - Intergenic
1138374123 16:56550933-56550955 TCCTTTTCTCCACGTGGAAGAGG - Intergenic
1139042313 16:63012662-63012684 CCCTTTTATCCCCAAGAAAGTGG - Intergenic
1139180972 16:64748055-64748077 AGCTGGTCTCCCCAAGGATGGGG - Intergenic
1139338231 16:66248525-66248547 TGCTGTTCATCCCAAGAAAGAGG + Intergenic
1141857217 16:86691542-86691564 TCCTGATCTCCAAAATGAAGGGG - Intergenic
1142049358 16:87947915-87947937 TCCTGTTCTTCACAAAGAATAGG + Intergenic
1142073279 16:88103147-88103169 TCCTGCTCTACCCAGGGGAGGGG - Intronic
1142145375 16:88490818-88490840 CCCTGCTGTCCCCCAGGAAGGGG + Intronic
1142429296 16:90017991-90018013 TCCTTTTTTCCCAAAGGAGGAGG + Intronic
1142753669 17:2003011-2003033 TGCTGTTCTTTCCAAGGGAGTGG + Intronic
1143503584 17:7352160-7352182 TCCTCTCCGCCCCCAGGAAGTGG - Exonic
1146161349 17:30560807-30560829 TCCTGTTCTGGCCAAGGGGGAGG + Intronic
1146808013 17:35880658-35880680 CCTTGTTGTCCCCAAGAAAGCGG - Intronic
1147042072 17:37726964-37726986 TCCTCTCCTCCTCAAGGTAGTGG + Intronic
1147114992 17:38292434-38292456 TCCTGTTTTTCCCAGTGAAGTGG - Intergenic
1147685444 17:42284174-42284196 ATCTGTTCTCCCCAGGGTAGGGG + Intergenic
1147689811 17:42308281-42308303 TCCTGACCGCCCCAAGGATGAGG + Exonic
1148414624 17:47496776-47496798 TCCTGTTTTTCCCAGTGAAGTGG + Intergenic
1148905600 17:50909904-50909926 TCCTGTGCCCTCCAGGGAAGGGG + Intergenic
1151489885 17:74426667-74426689 TCCTGTTCCCCCACAGGAAATGG - Intronic
1151817981 17:76480955-76480977 TCTCGTCCTCCCAAAGGAAGCGG + Intronic
1151938403 17:77278176-77278198 TGCTCTTCTCACCAAGGCAGGGG + Intergenic
1152187531 17:78867332-78867354 TCCTATTATCCCCAAGGAGAGGG + Intronic
1152251688 17:79215851-79215873 TGCTTTTGTCCCCAAGGCAGTGG + Intronic
1153275948 18:3368043-3368065 ATCTGTTCTCACCAAGGAACAGG + Intergenic
1155671564 18:28378015-28378037 TCCAGTACTCCCCATGGAATAGG + Intergenic
1156594073 18:38525795-38525817 TCCTGTCCTCCCTAAGGAGTAGG + Intergenic
1157922451 18:51727354-51727376 TCCTAGTCTCCCCAAGAAATTGG + Intergenic
1158132801 18:54171496-54171518 TCTTGTTGTCTGCAAGGAAGAGG - Intronic
1158307076 18:56117533-56117555 TTCTGTTCTCTCCAACAAAGAGG - Intergenic
1158940096 18:62399817-62399839 TCTTGTCCTCCCACAGGAAGGGG - Intergenic
1160155629 18:76431965-76431987 TCCTGTTCCCGCCAGGGCAGTGG - Intronic
1162043030 19:7981880-7981902 TCCTGCTCTGGACAAGGAAGTGG - Intronic
1164904842 19:31959110-31959132 TGCTGTCCTGCCCAAGGATGAGG + Intergenic
1165123774 19:33580096-33580118 TCCTGTTCTCCCACCGGAGGCGG + Intergenic
1165202114 19:34153651-34153673 TCCAGTTCTCGCCCATGAAGGGG - Intergenic
1165422492 19:35729143-35729165 TCCTCTTCTGCCCCAGGAGGCGG + Exonic
1166311053 19:41962840-41962862 TCCTGGGATCCCCAAGGAAGCGG + Intergenic
1166362012 19:42256436-42256458 CCTTGGTCTCCCCAAGGAGGAGG - Intergenic
1166566960 19:43771233-43771255 TCCTGTTGCCCTCAAGGATGAGG - Intronic
1168296399 19:55379111-55379133 TCCTGGTCTCCCCAGGGCAGGGG + Intergenic
925358883 2:3263368-3263390 TCCTGTTCTCAGGATGGAAGGGG - Intronic
926203472 2:10817990-10818012 TCCTGAGCACCCCTAGGAAGAGG - Intronic
927794040 2:26033385-26033407 TCCTCTCCTCGCCCAGGAAGAGG + Intergenic
928415406 2:31087568-31087590 TCCTTCTCTCCCCAAGTCAGTGG - Intronic
928791636 2:34963247-34963269 TCATGTAATTCCCAAGGAAGGGG + Intergenic
928883498 2:36123002-36123024 TCCTATACTCCCCTAGGAAGGGG - Intergenic
930021305 2:47003753-47003775 TCCTGTTCTCCCCATGGGCAGGG + Intronic
930617842 2:53612429-53612451 TAGTGTCCTCCCCTAGGAAGAGG + Intronic
931063931 2:58563112-58563134 TTCTGTTCCCTCCAAGGAAATGG + Intergenic
931696730 2:64876505-64876527 TTCTGTTCTCTGCAAGGAGGAGG - Intergenic
932437199 2:71709335-71709357 TACTGTTCTCCCCAGAGAATGGG + Intergenic
934115208 2:88783366-88783388 ACTTATTCTCCTCAAGGAAGAGG + Intergenic
935064324 2:99634802-99634824 TTCTGTTCTATCCAAGGAAGTGG - Intronic
935755073 2:106270473-106270495 TCCTGATCACCCCAAAGATGGGG + Intergenic
941011049 2:160299681-160299703 TCCTGCTCTCTCCCAGCAAGGGG - Intronic
941195445 2:162445197-162445219 TCCTTCTCTCCCCAACAAAGAGG - Intronic
943349931 2:186785374-186785396 TCATATACTCCCCTAGGAAGAGG + Intergenic
944326300 2:198408550-198408572 CCCTGTTCTCCTCACAGAAGTGG - Intronic
946878119 2:224150561-224150583 TCCTCTTCTCCACTAGGCAGTGG - Intergenic
1170870383 20:20200456-20200478 TCCTGTTCTCCCAATAAAAGTGG - Intronic
1171327050 20:24303956-24303978 TCCTGTCCTCACCAAGGGAGTGG + Intergenic
1172444929 20:34987939-34987961 CTCTGTTCTCTCCAAGGTAGAGG + Intronic
1172507506 20:35474384-35474406 TCCTGTGCTCCCAAAGGACTTGG - Intronic
1173540073 20:43844397-43844419 TCCTCTTCTCCCCAAGGCCCTGG - Intergenic
1173581842 20:44152501-44152523 CCCTGTTCTCCACAAAAAAGGGG + Intronic
1173660701 20:44731600-44731622 TCCTCTTCTCCACAAACAAGAGG - Intergenic
1178304033 21:31475510-31475532 TCCTTTGCACCCCAAGGAAGGGG - Intronic
1178358169 21:31925678-31925700 TCCTGTTGTTTCCTAGGAAGGGG + Intronic
1179628014 21:42659451-42659473 TCACTTTCTCCCCAGGGAAGTGG + Intronic
1180572795 22:16744301-16744323 TCCTTTCCTCCCCAAGAAATAGG + Intergenic
1181436520 22:22914331-22914353 CCCTGGTCTCCCCAAGGTACTGG + Intergenic
1181558910 22:23688381-23688403 TCCTGTTTCCCCCAAACAAGTGG - Intronic
1182422158 22:30253917-30253939 TCCTTCTCTTCCCAGGGAAGAGG - Intergenic
1185018939 22:48362309-48362331 CCCTGTGCTCCCCAGGGCAGGGG + Intergenic
1203247959 22_KI270733v1_random:87827-87849 ACCTATCCTGCCCAAGGAAGTGG + Intergenic
949577079 3:5348843-5348865 TCCCCTTCTCCCCAGGCAAGAGG - Intergenic
952639835 3:35580005-35580027 TCCAGTTCTTCCCAGGGCAGAGG - Intergenic
952827570 3:37537088-37537110 TTCTGATAACCCCAAGGAAGTGG - Intronic
952899138 3:38098049-38098071 TCCTGTTCTCCCCATCGCTGAGG + Intronic
953821420 3:46210496-46210518 CCCCCTTCTCTCCAAGGAAGAGG - Intronic
956469285 3:69548812-69548834 TCCTGATCTGCGCAATGAAGAGG - Intergenic
956484835 3:69711260-69711282 TCCTGTGCCCCCCAAGGAATGGG + Intergenic
956515252 3:70039428-70039450 TACTGGTCTCTCCAAGCAAGAGG + Intergenic
958594292 3:96201618-96201640 TCCTATTCTCCACCAGGCAGGGG + Intergenic
962870085 3:139481080-139481102 TCCTGTTCTGCCTTAAGAAGGGG - Intergenic
965967738 3:174515382-174515404 TCGTTTTATCCTCAAGGAAGAGG - Intronic
967111403 3:186297355-186297377 CCCACTTCTCCCCAAGGATGAGG + Intronic
967475149 3:189907944-189907966 TGCTGTTCACCCCAAGGCATTGG - Intergenic
967804956 3:193707602-193707624 ACCTGTTCTCCCTAAGGACATGG + Intergenic
971422695 4:26488679-26488701 GCCTGTTCTCCCCAAAGCTGGGG - Intronic
972264033 4:37441411-37441433 TCCTTTCCTCCACAAGGAAAAGG - Intronic
973772982 4:54223600-54223622 TCCTGCTATCCCCCAGGAACAGG + Intronic
975730455 4:77332753-77332775 TCCTATTCTCCTCAAGGGAAAGG - Intronic
977517624 4:98041402-98041424 TCCTCTTCTCCCACAAGAAGTGG - Intronic
978105416 4:104896281-104896303 TCCTGTTTTCCCCATAGTAGTGG - Intergenic
978892427 4:113846348-113846370 TTCTGATCTCCTCAAGGAGGAGG + Intergenic
978903438 4:113979746-113979768 TCCTGAGCTCCCCCGGGAAGAGG + Intergenic
979094668 4:116532109-116532131 TCCTGTCCTCCCCTAGAAACAGG - Intergenic
980107261 4:128599736-128599758 GCCTGTTCTCCCCAATTATGGGG - Intergenic
984643719 4:182198535-182198557 TCCTCTTCTCACCAAAGTAGCGG - Intronic
984750200 4:183265012-183265034 TGGTTTTCTCCCCAAGCAAGTGG - Exonic
984823989 4:183907350-183907372 CCCTGTTCTCCAAAAGGAACAGG + Intronic
985869514 5:2542926-2542948 GCCTGCTCTCCCCATGGAACAGG + Intergenic
986338170 5:6770003-6770025 TCCTGTTCTGGCACAGGAAGGGG + Intergenic
991579661 5:68141079-68141101 TCATGTTCTCCTCAAGGAAGAGG + Intergenic
991654130 5:68886064-68886086 TCATTTTTTCCTCAAGGAAGTGG - Intergenic
992644576 5:78799922-78799944 TCCTTCTTTCCCCAAGAAAGAGG - Intronic
994968432 5:106703785-106703807 TCCCCTCCTCCCCCAGGAAGAGG - Intergenic
995418591 5:111937073-111937095 TGCTGTTCTCCTGAAGGGAGTGG - Intronic
995530802 5:113090181-113090203 TCCTTTTCTCCCCGAGAAAAAGG - Intronic
998710397 5:144818216-144818238 GACTGGCCTCCCCAAGGAAGTGG - Intergenic
1001832303 5:174799095-174799117 TCCTGTGCTCCCAGAGGAGGGGG - Intergenic
1003570797 6:7255148-7255170 TCCTGTCCTCCTCAGGGAGGTGG - Intergenic
1004658007 6:17683513-17683535 TCTTTTTGTCCCCAAGCAAGAGG + Intronic
1005021964 6:21426919-21426941 TCCTGCTCTCACCAAGGAGCAGG - Intergenic
1005211238 6:23466547-23466569 TCCTATTCTCATAAAGGAAGTGG - Intergenic
1005691795 6:28313558-28313580 TCCTGTTCTCCCCCAAGATGGGG - Intergenic
1005706989 6:28465019-28465041 TCCTGTTCTCCTGAAGCAACAGG - Intergenic
1011786855 6:90856334-90856356 TGCTGTTCTAGGCAAGGAAGAGG + Intergenic
1015125472 6:129749534-129749556 TCCTGTGCTCCTGAAGGGAGAGG + Intergenic
1017527393 6:155253641-155253663 TCCTGTTCCTTCCAAGGAAAGGG + Intronic
1018443734 6:163835965-163835987 TGTTGTTCTCCCCAAGCAACTGG - Intergenic
1019490097 7:1308574-1308596 TCCTGAGCTCCCCAGGGAAGGGG + Intergenic
1021351689 7:19602134-19602156 CCCTGTTCAGCCCAAGGGAGTGG + Intergenic
1024654007 7:51434003-51434025 TACTGTTCTCTCCTAGGAAAGGG + Intergenic
1029685666 7:102146102-102146124 CCCTGCTCTACCCAAAGAAGTGG - Intronic
1030493972 7:110273932-110273954 TCCTTTTTAACCCAAGGAAGAGG - Intergenic
1030872487 7:114774464-114774486 TCCTGTACTTCCCAAACAAGTGG - Intergenic
1031232628 7:119128528-119128550 TGCTATTTTCCCCAAGGAAGTGG - Intergenic
1031402783 7:121345553-121345575 TCCTGTTCTCCCTTAGGGAAAGG - Intergenic
1032080885 7:128857942-128857964 TCCTGTTCTTCCCCAGGCAGGGG - Intronic
1032091363 7:128913218-128913240 TCCCGTTCTTCCCCAGGCAGGGG + Intergenic
1032547407 7:132755452-132755474 TCCCTTTCTCCACAAGGAACAGG + Intergenic
1033445337 7:141416600-141416622 TTCAGTTCTCCCAAAGGAAACGG - Intronic
1034700471 7:153091033-153091055 TCCTTTTTTCCCCAAGCCAGAGG - Intergenic
1035104617 7:156431829-156431851 TCCTGCTCTGGCCATGGAAGAGG + Intergenic
1035465351 7:159071557-159071579 TCCTGTTCTGGACAAGGAGGGGG - Intronic
1036604380 8:10292948-10292970 TCCTGTAGGCCCCAGGGAAGGGG + Intronic
1037771174 8:21800993-21801015 CCCTGTTCTCCTTAGGGAAGTGG - Intronic
1040504784 8:48037368-48037390 GCCTCTTCTCCCCAGGGCAGTGG + Intronic
1045564284 8:103298503-103298525 TCCTGAAATCCGCAAGGAAGTGG + Intronic
1046129514 8:109949217-109949239 GACTGAGCTCCCCAAGGAAGAGG + Intergenic
1047360592 8:124165277-124165299 TCCTGTTTTACTCAAGGTAGTGG - Intergenic
1050751717 9:8946585-8946607 TTCTTCTATCCCCAAGGAAGTGG + Intronic
1052137517 9:24932420-24932442 TACTGTTCTCCTCAAAGAACTGG + Intergenic
1053318671 9:37075803-37075825 ACCTGTTCTTCCCACGGCAGTGG - Intergenic
1053322817 9:37115516-37115538 ACCTGTTCTTCCCACGAAAGTGG - Intergenic
1055819798 9:80248106-80248128 TCCTGTTCTCCCAATGCCAGTGG - Intergenic
1056462833 9:86824820-86824842 GCCTGTTGTCCATAAGGAAGTGG + Intergenic
1056823561 9:89861104-89861126 GCCTATGCTCCCCAAGGTAGAGG - Intergenic
1056905749 9:90646211-90646233 TCCTGTTCTCCCTAAGACAGTGG + Intergenic
1056992549 9:91424402-91424424 TCCTGCCCACCCCAAGGTAGAGG - Intergenic
1057713696 9:97470305-97470327 TCTTGTTCTTCCCATTGAAGGGG + Intronic
1058218919 9:102271521-102271543 TCCTGTTGTCACCCAGGTAGTGG + Intergenic
1058383919 9:104410454-104410476 TCTTTTTCTCTCCTAGGAAGTGG + Intergenic
1061039395 9:128131178-128131200 GCCTATGCTCCCCAAGGTAGAGG + Intergenic
1061800143 9:133109232-133109254 TCCTGTTCTCCCAGAGGGTGGGG + Intronic
1061973787 9:134058263-134058285 TCCTTTTCTCCCCAGCCAAGGGG - Intronic
1062416907 9:136455787-136455809 TCTTGTTCTCCCTCAGGAGGGGG - Exonic
1187120677 X:16403340-16403362 ACCTATTCTCTCCAAGGTAGGGG - Intergenic
1188674556 X:32922772-32922794 TGCTGTTCTCCCCAAAGCAGGGG - Intronic
1192801023 X:74465144-74465166 TCCAGTACTCCCCAAGGAAATGG + Intronic
1192938653 X:75888770-75888792 TGGTGTTCTCTCAAAGGAAGAGG - Intergenic
1194538550 X:95141033-95141055 TACTGTGGTCCCCTAGGAAGAGG - Intergenic