ID: 1069827392

View in Genome Browser
Species Human (GRCh38)
Location 10:71262490-71262512
Sequence TCTGGGTCCTGTTCTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069827392_1069827395 -9 Left 1069827392 10:71262490-71262512 CCTTGGGGAGAACAGGACCCAGA 0: 1
1: 1
2: 3
3: 41
4: 308
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data
1069827392_1069827394 -10 Left 1069827392 10:71262490-71262512 CCTTGGGGAGAACAGGACCCAGA 0: 1
1: 1
2: 3
3: 41
4: 308
Right 1069827394 10:71262503-71262525 AGGACCCAGAGGAGCCCGCCCGG No data
1069827392_1069827402 16 Left 1069827392 10:71262490-71262512 CCTTGGGGAGAACAGGACCCAGA 0: 1
1: 1
2: 3
3: 41
4: 308
Right 1069827402 10:71262529-71262551 ACTCATTCATTCATGCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069827392 Original CRISPR TCTGGGTCCTGTTCTCCCCA AGG (reversed) Intronic
900874229 1:5330233-5330255 TCTAGGTAGTGTCCTCCCCAAGG - Intergenic
900973250 1:6002986-6003008 TCTAGGACCTGTTCTCACCCGGG - Intronic
900990648 1:6096787-6096809 GCTGGGGCAGGTTCTCCCCAGGG - Intronic
902958160 1:19941154-19941176 CCTGGGTTCTGTCCTTCCCAAGG + Intergenic
903454458 1:23477602-23477624 TCTGGGTCCTCATCTCTTCAGGG - Intronic
904500364 1:30909297-30909319 TCTGGGCCTCGGTCTCCCCAGGG + Intergenic
904750782 1:32740642-32740664 TCTTGGTCCTGGTCTCCACGAGG - Intergenic
905394766 1:37660129-37660151 TCAGAGTCCTGTTCTGCTCAAGG + Intergenic
905483901 1:38282208-38282230 TCTGGGGCATGTTCTTCTCATGG + Intergenic
906813603 1:48854302-48854324 TCTGTGGTCTGCTCTCCCCAGGG + Intronic
906857663 1:49325883-49325905 TCTTGCTCCTGTTCCCTCCATGG + Intronic
907052485 1:51339196-51339218 TTTGGCTCCTTTTCTTCCCATGG - Intronic
907880942 1:58548799-58548821 TCAGGATCCTGTTATCCCAATGG + Intergenic
909787111 1:79627991-79628013 TCTGGGTTCTGTTTGCCCTAAGG - Intergenic
911460390 1:98181941-98181963 TCTGGGCCCTTCTCTTCCCAAGG - Intergenic
912018367 1:105071710-105071732 TCTGGGTGGTGTGTTCCCCAAGG + Intergenic
912812954 1:112807566-112807588 TCTCAATCCTTTTCTCCCCAAGG - Intergenic
913062831 1:115223546-115223568 TCTGGGTCCTGCTATTTCCATGG + Intergenic
914992881 1:152514019-152514041 TCTTGGTCCTTGGCTCCCCAGGG - Intronic
915339076 1:155166641-155166663 ACAGCGTCCTGTTCTCACCAAGG + Intergenic
915563953 1:156703677-156703699 TGGGGGTCCTGGGCTCCCCAGGG - Intronic
915948439 1:160171262-160171284 TCTGGGAGCTGTCCTCCCGAAGG - Exonic
916059471 1:161088864-161088886 TGAGGATCCTGTTCACCCCAGGG - Intronic
916456357 1:164974813-164974835 TCTGGGTCCCTCTCTCCACATGG + Intergenic
916550134 1:165842193-165842215 TCTGGGCCCTTTTCTGCCTATGG + Intronic
916738079 1:167625945-167625967 TCTGGCTCCCGTTGTCCTCAAGG + Intergenic
918203852 1:182291724-182291746 TCTGGGTACTTTTCTATCCAGGG - Intergenic
918303508 1:183225412-183225434 TCTGGGGTTTGTCCTCCCCATGG + Intronic
918656154 1:187028333-187028355 GCTGTGCCCTGTTCCCCCCAGGG + Intergenic
920640392 1:207746498-207746520 TATGAGGCCAGTTCTCCCCAAGG - Intergenic
920833106 1:209482791-209482813 TCTGGATCCTGCTATCACCAGGG - Intergenic
921034715 1:211365768-211365790 TCTAAGTCCAGTACTCCCCATGG + Intronic
922550737 1:226492307-226492329 TATGAGGCCAGTTCTCCCCAAGG + Intergenic
923180396 1:231512603-231512625 ACTGGTTCCTGTTCTCCCCAAGG - Intergenic
923263503 1:232289893-232289915 TCTGGGCTCTGTTCCCCACACGG + Intergenic
1063849225 10:10165007-10165029 TCTGAGCCCTGTTCTCCACTAGG - Intergenic
1064031111 10:11883465-11883487 ACTGGATCGTGCTCTCCCCATGG - Intergenic
1064339573 10:14474160-14474182 TCAGGCTCATGTTCTCCCCTGGG + Intergenic
1065259961 10:23914020-23914042 GCTGGGTCCCTTTCTCCCAAGGG - Intronic
1066657832 10:37711991-37712013 GCTGTGTCCTGTTCTTCTCAAGG - Intergenic
1066783807 10:38980064-38980086 TCTGGCTGCTGCTGTCCCCAAGG + Intergenic
1066984602 10:42454102-42454124 TCTGGCTGCTGCTGTCCCCAGGG - Intergenic
1067270082 10:44784134-44784156 TCTGAGTCCTGTTCAACCCAGGG + Intergenic
1067370703 10:45679079-45679101 TCTGGCTGCTGCTGTCCCCAAGG + Intergenic
1067445185 10:46337485-46337507 TCTGGCTGCTGCTGTCCCCAAGG + Intergenic
1067592185 10:47523243-47523265 TCTGGCTGCTGCTGTCCCCAAGG - Intronic
1067639301 10:48031315-48031337 TCTGGCTGCTGCTGTCCCCAAGG - Intergenic
1067829588 10:49602798-49602820 GCTGTTTCCTGGTCTCCCCAGGG + Intergenic
1067874186 10:49988977-49988999 TCTGGCTGCTGCTGTCCCCATGG + Intronic
1068857031 10:61808317-61808339 TCTGGCTCCAGTCCTCCCCATGG - Intergenic
1069634412 10:69916752-69916774 TCTGGGTCTAACTCTCCCCAAGG - Intronic
1069827392 10:71262490-71262512 TCTGGGTCCTGTTCTCCCCAAGG - Intronic
1070136293 10:73697472-73697494 TCTGGCTGCTGCTGTCCCCAAGG - Intronic
1070751408 10:78966093-78966115 CCTGGGCCCTGTTCTACTCAGGG - Intergenic
1071411516 10:85401572-85401594 TCTGCCTCCAGGTCTCCCCATGG + Intergenic
1071492354 10:86144450-86144472 CCTGTGTCCTCTCCTCCCCATGG - Intronic
1072155446 10:92719335-92719357 TCTGGGCCCTGGTCTACCCCAGG + Intergenic
1072320813 10:94247855-94247877 TCTGTATCCTCTTTTCCCCAAGG - Intronic
1074213948 10:111365854-111365876 TCTGGGTCCTGGTGTCACTAAGG - Intergenic
1074294190 10:112167973-112167995 TCTGCGGTTTGTTCTCCCCAGGG - Intronic
1074853262 10:117455556-117455578 CCTGAGTCCTGGCCTCCCCACGG + Intergenic
1075294515 10:121262629-121262651 TTTGGGTCCTTTTCACCCCCTGG + Intergenic
1075376404 10:121981221-121981243 TCTTGGTCCTGCTCTGCCCAGGG - Intergenic
1076462258 10:130655419-130655441 TCTCGTTCCTGTTGGCCCCAGGG - Intergenic
1076739823 10:132477652-132477674 TCTGGCTCCTGTTCTCTCCTGGG - Intergenic
1077197819 11:1290066-1290088 ACAGGGTCCTGCTCTCCCCAAGG - Intronic
1077330810 11:1983101-1983123 TCTGGGCCCTGCTCCCACCAGGG + Intronic
1077520212 11:3028773-3028795 TCTGGGTTAGGTTCTCACCATGG + Intronic
1077798796 11:5517982-5518004 TCTTGCCCCTTTTCTCCCCAGGG + Intronic
1078145423 11:8718927-8718949 CCAGGGACCTGTTCACCCCACGG - Intronic
1078436677 11:11331151-11331173 TCCAGATCCTGTTGTCCCCATGG - Intronic
1080001071 11:27350914-27350936 TCTGGGTTCTTTTTTCCCTAAGG - Intronic
1081001329 11:37676287-37676309 TCTGGGGCATGTTCTTCTCAGGG - Intergenic
1081683771 11:45027140-45027162 TCTGCATCTTGTTCTCCCAAAGG + Intergenic
1081909887 11:46694121-46694143 TCTGGGTGATGGTGTCCCCATGG - Intronic
1083116912 11:60469588-60469610 TCTGAGTCTTTTTATCCCCATGG - Exonic
1083307851 11:61770173-61770195 CCTGGGCACTGTCCTCCCCAAGG - Intronic
1083327695 11:61881523-61881545 GCTGGGTGGTGTTGTCCCCATGG + Intronic
1083708869 11:64535133-64535155 TCTGGGAACTGTCATCCCCAGGG + Intergenic
1084441983 11:69179751-69179773 TCTGGGTCCGGTTGCCCTCACGG - Intergenic
1084477991 11:69399815-69399837 GCTGGGTCCTGTGCCCCACATGG - Intergenic
1084788948 11:71461369-71461391 TCTTGCTCCTGTTCTTGCCATGG - Intronic
1085698574 11:78726644-78726666 TCTTGGTGCTGTTCTCATCATGG + Intronic
1086288492 11:85276935-85276957 TCTGTTTCCTGTACTGCCCAAGG - Intronic
1086297912 11:85391859-85391881 TCTTGGTCCAGTTCTCAGCAGGG - Intronic
1089508475 11:118980411-118980433 TCTGGGGCATGTTCTACCCAGGG - Intronic
1090056909 11:123431254-123431276 ACGGGCTCCTGTTCTCCCCCAGG - Intronic
1090291373 11:125548141-125548163 TATGAGGCCAGTTCTCCCCATGG + Intergenic
1090728861 11:129552391-129552413 TCTTTTTCCTGTTCTCACCATGG + Intergenic
1090878739 11:130814864-130814886 TCTGAGTGCTGTTCTGACCAGGG - Intergenic
1202813790 11_KI270721v1_random:38280-38302 TCTGGGCCCTGCTCCCACCAGGG + Intergenic
1092488026 12:8919648-8919670 TCTGGTTTCTGTCCTTCCCATGG + Intronic
1092728069 12:11504057-11504079 TCTGGGTTTTCTTCCCCCCAAGG + Intergenic
1093745992 12:22741708-22741730 TGTGGGTCCTCTTCTCTCAAAGG + Intergenic
1096149151 12:49297799-49297821 TCAGGGATCTCTTCTCCCCACGG + Intronic
1097909018 12:64949245-64949267 TCTGGTTTCTGTTTTCCCCATGG + Intergenic
1100444547 12:94649536-94649558 TCTGTAACCCGTTCTCCCCAGGG - Intronic
1101814061 12:108131626-108131648 TCTGGGTGCTGTTTTCCCCAGGG + Intronic
1102300478 12:111767365-111767387 TCGGGGTTCCGTTCTCCCCATGG + Intronic
1102518727 12:113466277-113466299 TCACTGTCCTGTTCTTCCCAGGG - Intronic
1103481753 12:121254594-121254616 TCAGGGTCCTGTTCACCTCCTGG - Intronic
1107595574 13:41960427-41960449 TCTGTGTCATGTTCTAGCCAGGG - Intronic
1110644638 13:77868201-77868223 TCTGGGTCCTGATCTCCCCAGGG - Intergenic
1112336744 13:98522819-98522841 CCTGGGTCCTGTTCGAGCCAGGG - Intronic
1112357208 13:98683689-98683711 TCCTGGTCCTGTTTTCCCCAGGG - Intergenic
1113281344 13:108791695-108791717 TCTGGTATCTTTTCTCCCCATGG - Intronic
1113594045 13:111519107-111519129 CCTGGGGCCTGTTCTCCAAACGG - Intergenic
1113787207 13:113008728-113008750 TCTGTCTCCTGTTTTCTCCAAGG + Intronic
1113892441 13:113743502-113743524 TCTCCGTCCCGTCCTCCCCAGGG - Intergenic
1114046430 14:18880495-18880517 TCTGGGTTCTGCGCTGCCCACGG + Intergenic
1114117782 14:19638955-19638977 TCTGGGTTCTGCGCTGCCCACGG - Intergenic
1114631104 14:24160218-24160240 TCTGCTCCCTTTTCTCCCCAGGG + Exonic
1115345903 14:32343191-32343213 TCTGGGTCCTATTTTCTTCACGG + Intronic
1117063262 14:51983901-51983923 TCTTGCTCCTGTTCTGGCCATGG + Intergenic
1117400070 14:55351135-55351157 TCTGAGTCCTATTCTGCCCCAGG + Exonic
1119674965 14:76546729-76546751 TCTGGTTCCTGTTCCCCACCTGG - Intergenic
1120948150 14:90017097-90017119 TCTAGCTTCTGTTCTCCACATGG - Intronic
1121491452 14:94364128-94364150 CCTGGGTACTGTCCTCCTCATGG + Intergenic
1121494189 14:94380660-94380682 CCTGGGTACTGTCCTCCTCATGG + Intronic
1122632137 14:103111931-103111953 TCCTGGTCAGGTTCTCCCCAAGG + Intergenic
1122795693 14:104205138-104205160 TCCAGTTCCTGTTCTCCCTAAGG - Intergenic
1202902102 14_GL000194v1_random:50020-50042 TCTGTGTCCTATTTTTCCCATGG + Intergenic
1124106726 15:26745043-26745065 TCTTGCTCCTGTTCTCGCCAAGG - Intronic
1124363067 15:29053179-29053201 CCTTTGTCCTCTTCTCCCCATGG + Intronic
1124364095 15:29060019-29060041 TACGGGTCCTTTACTCCCCAGGG - Intronic
1124883137 15:33660409-33660431 TCTGGTACCTGTTCTCCTCGGGG - Exonic
1125974332 15:43937766-43937788 TCTGGCTCCAGATCTCCCCATGG - Intronic
1126118314 15:45228858-45228880 TCTGTGTGCTGTTCTCCCTCAGG + Intergenic
1126674855 15:51152301-51152323 TCTGGCTTCTGTTTTTCCCAAGG + Intergenic
1128609731 15:69064006-69064028 GCAGGAGCCTGTTCTCCCCAAGG + Intergenic
1128660057 15:69493562-69493584 TCTGAGTCCTGCCCACCCCATGG + Intergenic
1129660295 15:77549480-77549502 TCTGCGTTCTGGCCTCCCCAGGG + Intergenic
1130151721 15:81316248-81316270 TCTGGGTTTAGTTTTCCCCAAGG + Intronic
1130559175 15:84945229-84945251 TCTGAGGGCTGTTCTCCCCCGGG + Exonic
1131397569 15:92098494-92098516 TCAAGGTCCTGTTCTCACCTGGG - Intronic
1132586531 16:707959-707981 ACATGGTCCTGTTCTTCCCAGGG + Intronic
1132629088 16:908167-908189 TGTGGGTCCTGATCTTTCCAGGG - Intronic
1132845998 16:2001174-2001196 TCTCGGTCCTCTTCTTCCCTGGG + Exonic
1132882982 16:2170542-2170564 GCTGGGTCCTGTCCTCCCCGAGG + Intronic
1134086739 16:11362498-11362520 TCTGGGTCCTGTGCCTCCCACGG + Intronic
1140476394 16:75241456-75241478 GCAGGGTCCTGTTATCCCCTGGG - Intronic
1140836460 16:78798871-78798893 GCAGTGTCCTTTTCTCCCCAGGG + Intronic
1141346414 16:83250693-83250715 TCTGGGTCCTGCTTTCCTCTTGG - Intronic
1142426802 16:90005940-90005962 CCTGGGTCCCCTTCACCCCAAGG + Exonic
1143633266 17:8150714-8150736 TCTCTGTTCTGTTCTCCCCATGG - Exonic
1144593437 17:16544671-16544693 TATGAGGCCAGTTCTCCCCAAGG - Intergenic
1144788404 17:17844367-17844389 GCTGGGTCCTCTCCTCCCCAGGG + Intronic
1147911283 17:43857738-43857760 TCTGGGTCCTGTTCTCTGTTTGG - Intronic
1149432936 17:56608911-56608933 TCTGGGGCCTGTTCTGACTATGG + Intergenic
1149733578 17:58971155-58971177 CCTGCCTCCTGTTCTCTCCAGGG + Intronic
1150292757 17:63990942-63990964 TCTGTGGCCTGTGGTCCCCACGG + Intergenic
1151154410 17:72114821-72114843 CCAGGGTCCACTTCTCCCCAGGG - Intergenic
1151729980 17:75905208-75905230 GCTGCGTCCTGATTTCCCCAGGG + Exonic
1152465833 17:80465768-80465790 GCTGGGTGGTGTTCACCCCAGGG - Intergenic
1153047374 18:869201-869223 ACTGGGGCCGTTTCTCCCCATGG - Intergenic
1153467394 18:5404148-5404170 TCAGGGTGCTGTGCTCCCCATGG - Intronic
1153500502 18:5744519-5744541 TCTAGGTGGTGTGCTCCCCAAGG + Intergenic
1155998594 18:32358951-32358973 GCTGGGTCCTGTTCACTGCACGG + Intronic
1160730880 19:641159-641181 TGTGGGTGCTGTGCTCCGCATGG + Intronic
1160807428 19:998627-998649 GCTGGGTCCTGGTGTCCTCAGGG - Intergenic
1160959868 19:1715687-1715709 TCTGGGGCCTGTGGTACCCAGGG + Intergenic
1161401835 19:4069282-4069304 TCTGAGTCAGGTTCTCACCATGG - Intergenic
1161439588 19:4283089-4283111 TCTGGGTCCTGTTCCTCATAAGG - Exonic
1163018238 19:14469848-14469870 TCTGGGTCCTGTCCCCACAACGG - Intronic
1163515817 19:17762949-17762971 TCTGGTTCCTGGAATCCCCAGGG - Intronic
1164442392 19:28289330-28289352 TCTGGGTCCCCTTCACCACAAGG + Intergenic
1164864378 19:31591663-31591685 ACTGGGGCATGTTCTCCCCATGG - Intergenic
1166719653 19:44989772-44989794 TCTGAGCCCTGGTCTCACCACGG - Intronic
1166723665 19:45012228-45012250 CCTCGGTGCTGCTCTCCCCAAGG - Exonic
1167477944 19:49711794-49711816 TGTGGGTCCTGCAGTCCCCAGGG - Exonic
925328189 2:3038897-3038919 TCTGTGCCCTGGTCACCCCAGGG - Intergenic
925465893 2:4107142-4107164 TGTGAGTGCTGTTCTCTCCAGGG - Intergenic
926229564 2:10992393-10992415 TCTGGGGGCACTTCTCCCCATGG - Intergenic
926282974 2:11465660-11465682 TCTGGGTCGTCTGCTCCCCCTGG - Intronic
926310368 2:11670308-11670330 TCTGGGTTCAGTTCAACCCAGGG + Intergenic
926971467 2:18471439-18471461 TCTCAGCCCTGCTCTCCCCAGGG + Intergenic
929547184 2:42863358-42863380 TCTGGGTCCTGCCCTTCCCAGGG + Intergenic
930021301 2:47003747-47003769 GCTCCTTCCTGTTCTCCCCATGG + Intronic
930909638 2:56616467-56616489 TCTGTCTCTTGTTCTCCCCATGG + Intergenic
931291472 2:60877797-60877819 TCTGAGCCCTGTTCTCCACTAGG + Intergenic
932616280 2:73233573-73233595 TCTCGGTCCTGTCCACTCCAAGG + Intronic
933421005 2:82044338-82044360 TCTGGATCCTGTCCTCACCATGG - Intergenic
933774152 2:85761722-85761744 TCTGCCTCCTCTTCACCCCAGGG - Intronic
936042835 2:109162832-109162854 GCTGGGTCCTTTTCTCACCTTGG + Intronic
936551961 2:113451615-113451637 CCAGGGTGCTTTTCTCCCCAGGG - Intronic
936894090 2:117407068-117407090 TATGGGTCTTTGTCTCCCCAAGG - Intergenic
938266925 2:129934410-129934432 TCTGGGTTCTGCGCTGCCCATGG - Intergenic
942189515 2:173456360-173456382 TCTGGGCCCAGTCTTCCCCAAGG - Intergenic
945025113 2:205613084-205613106 TTAGGGTCCTGTTCTCTCCCTGG - Intronic
947874993 2:233461940-233461962 TGAGGGTCCTTTTGTCCCCAGGG + Intronic
948532889 2:238623998-238624020 TCTTGCTCCTGTTTTCACCATGG + Intergenic
948621924 2:239240862-239240884 TCTTAGTCCTGTTCCTCCCATGG - Intronic
948717055 2:239871873-239871895 TCTGGGTCCTATCTTCCCCATGG - Intergenic
948768742 2:240236570-240236592 CCTGGCTCCTGCTGTCCCCAGGG - Intergenic
948884622 2:240876573-240876595 TCTGGGTCCTGTGTCCCACAGGG + Intronic
1168965842 20:1897423-1897445 TCGGGGTCCTGGTCACACCATGG + Intronic
1170581025 20:17699779-17699801 TCTGGGTGCTGTTCTCAGCTGGG - Intronic
1171965501 20:31527021-31527043 TCAGGGTCCAGATCTCCTCATGG + Intronic
1173283304 20:41648504-41648526 TCGGGGTCCTGCTCTCCCCTGGG - Intergenic
1173822130 20:46026328-46026350 TCTGGCCCCAGATCTCCCCAGGG + Intronic
1173973668 20:47171702-47171724 ACTGGTTCCTGCCCTCCCCAAGG + Intronic
1174163821 20:48570619-48570641 TCTTTGTCCTGTTCTCCTGAGGG - Intergenic
1174322954 20:49756631-49756653 TCTTGCTCCTGTTCTGCCCAGGG + Intergenic
1175012289 20:55750754-55750776 TCTGGGTCATGGTGTTCCCAAGG - Intergenic
1175064100 20:56270593-56270615 TCTTGTTCCTGTGCTCCCCAAGG - Intergenic
1175920956 20:62450523-62450545 TCTGGGCCCTGCAGTCCCCATGG + Intergenic
1176621471 21:9064787-9064809 TCTGTGTCCTATTTTTCCCATGG + Intergenic
1179363399 21:40733617-40733639 TGTGGGTCCTGCTCTCCCTCTGG + Intronic
1179946682 21:44682890-44682912 TGTGGGGCCTGCTCTCCACACGG - Intronic
1180062134 21:45390899-45390921 TCTCCGTCCTGCCCTCCCCACGG - Intergenic
1180082805 21:45494343-45494365 AGTGGCTCCTGTCCTCCCCAGGG + Intronic
1180464966 22:15603131-15603153 TCTGGGTTCTGCGCTGCCCACGG + Intergenic
1181643917 22:24220071-24220093 TCTGGGTCTGGTTCTGGCCACGG + Exonic
1181837362 22:25621895-25621917 TATGGGGCCAGTTCTCCCCAAGG + Intronic
1181895863 22:26106865-26106887 GCTGGGTCCTGCACTCCCCTGGG + Intergenic
1182121160 22:27787803-27787825 TCTGGGTCCTGACCTACCCAGGG + Intronic
1182775759 22:32829858-32829880 TCTTGGTCCCATTCTACCCAAGG - Intronic
1183336630 22:37251539-37251561 CCTTGGTCCTGTTCTTGCCATGG - Intergenic
1183952584 22:41359848-41359870 TCTGGGACCTGTGTTCCCCCCGG + Exonic
1184119680 22:42441644-42441666 TCTGGGATCTATTCTCCCTAAGG + Intergenic
1184457877 22:44621766-44621788 TCTGGGGCCAGTTCTGCCCTGGG - Intergenic
1184529060 22:45042875-45042897 TCAGGGGCCTGTTCTTCCCAGGG - Intergenic
1184901027 22:47446500-47446522 TCAGGGTCCCGTTCTTCCCCGGG - Intergenic
1184913478 22:47551140-47551162 TTTGGCTCCTGCTCTTCCCATGG + Intergenic
1185156429 22:49195970-49195992 TCTGGCTGTTGTTCTCCCCTGGG - Intergenic
1185270858 22:49928865-49928887 CCTGGCTCCTCTTCTCCCCTGGG - Intergenic
950175702 3:10872771-10872793 TCTCGCTCCTGTTCAACCCAGGG - Intronic
950590883 3:13935142-13935164 TCTGGTTGCTTTTCTCCTCATGG - Intergenic
952342750 3:32459505-32459527 TCTGGGAGCTGTTCAACCCAGGG + Intronic
953042458 3:39267375-39267397 TCCGGGTGCTGTTCTGCCCAAGG - Intronic
953277888 3:41521803-41521825 TTTGGGTCTTAATCTCCCCAGGG - Intronic
954143432 3:48621948-48621970 TCTGGGTCCTGCTGTCCCAGCGG + Intergenic
954927800 3:54252654-54252676 TCTCTGCTCTGTTCTCCCCAGGG + Intronic
955974134 3:64464314-64464336 TCTGTTTCCTCTACTCCCCAGGG - Intergenic
957127860 3:76185533-76185555 CCTGGGTCCTGTTCTCACAACGG - Intronic
958756957 3:98260698-98260720 TCTGGGCCTGGTTCTCCCCTAGG + Intergenic
959279184 3:104316555-104316577 TCTGGGCCCAGTTCTCCACTAGG - Intergenic
959626821 3:108461980-108462002 CCTGGGTTCTGATTTCCCCATGG - Intronic
959901362 3:111665505-111665527 TCTGGGTCTTATTCTACCCTAGG + Intronic
961604244 3:128082129-128082151 CCTGGCTCCTGTTCTCCCGGTGG - Intronic
965127771 3:164651363-164651385 TCTTGCTCCTGTTTTCACCATGG - Intergenic
965456544 3:168908381-168908403 TCTGGCTCCAGTTCTCCCACGGG - Intergenic
968718245 4:2177942-2177964 CGTGGCTCCTGTTCTTCCCAAGG + Intronic
969432168 4:7161733-7161755 TCAGGTTCCTGCCCTCCCCATGG + Intergenic
969569591 4:8000812-8000834 CCTGTGTGCTTTTCTCCCCATGG - Intronic
969594772 4:8142796-8142818 TCTGGACCCTGCCCTCCCCAAGG + Intronic
969680927 4:8643015-8643037 CCTGCGTCTTGTTGTCCCCAAGG + Intergenic
969878738 4:10155817-10155839 TCTGGGTCCTCTTCTCACCAGGG - Intergenic
977752188 4:100622530-100622552 TATGAGGCCAGTTCTCCCCAAGG + Intronic
977903895 4:102454255-102454277 TCTAGCTCCTTTTCTTCCCAGGG - Intergenic
982260254 4:153488425-153488447 TCTGGGCCCTGCCCTCACCAGGG - Intronic
982782509 4:159506197-159506219 CCTGGCTCCTGTCCTCCTCAGGG - Intergenic
984162053 4:176264953-176264975 TCTAGGTCCTCATCTCCTCATGG + Intronic
984184903 4:176532107-176532129 TCTGAAGCCTGTACTCCCCATGG + Intergenic
984444957 4:179824970-179824992 TCTGGTACCTGGTCTCCACAAGG + Intergenic
985488979 5:168057-168079 TCTGGGTCCTGCCCTGCCCTGGG + Intronic
985705090 5:1395787-1395809 TGTGAGTCCTGTTCCCCCCAGGG + Intronic
988725567 5:33922948-33922970 TCTGGAGACTGTTTTCCCCAAGG - Intergenic
991134772 5:63168482-63168504 TCTGGGTCTTCATCTCCTCATGG - Intergenic
991184212 5:63788452-63788474 TCTAGGTCCTGTTCTCTAGAAGG - Intergenic
993376461 5:87154481-87154503 ACTGAGGCATGTTCTCCCCAAGG - Intergenic
993920353 5:93793854-93793876 TTTGGGTTCTGAGCTCCCCAGGG - Intronic
993991246 5:94660855-94660877 TTTGGCTCCTTTTGTCCCCAGGG + Intronic
996476329 5:123926198-123926220 TATGAGGCCAGTTCTCCCCAGGG + Intergenic
997232840 5:132256836-132256858 TTTGGGCCCTTTTCTCTCCAAGG - Intronic
997644058 5:135468581-135468603 TCTGGGTTGTGTTCTCCATATGG + Intergenic
998263636 5:140650268-140650290 TCAAGTTCCTCTTCTCCCCAAGG - Intronic
998345428 5:141457904-141457926 TGTGAGGCCAGTTCTCCCCAAGG + Intronic
998855774 5:146393915-146393937 TCTGAGTCTGGTTCTCCCTATGG + Intergenic
1000375458 5:160576811-160576833 TCTGGGTCCTGCTGGCCCCCTGG - Intronic
1001247732 5:170117688-170117710 ACTGTGTCCTGCTCTCACCATGG - Intergenic
1001525000 5:172422559-172422581 TCTGAGTCTTGTGCTCCCCCTGG - Intronic
1001982124 5:176044748-176044770 TCTGGGACCTGTTGTCCACCCGG + Intergenic
1002193317 5:177489896-177489918 CCTGGGTCCTGCTGGCCCCACGG + Intronic
1002235337 5:177799309-177799331 TCTGGGACCTGTTGTCCACCCGG - Intergenic
1002321414 5:178378253-178378275 TGTGGGGCCTGTTATCCCCTTGG - Intronic
1002323000 5:178386799-178386821 TGTGCGTCCTGTTCTCTCCCAGG - Intronic
1002772680 6:303003-303025 TCTGAGTCCTTTTCTCAACAAGG - Intronic
1003558759 6:7163981-7164003 GCTGGCTCCTGTTCTCCCATGGG + Intronic
1005119574 6:22375097-22375119 TATGAGGCCAGTTCTCCCCAAGG - Intergenic
1005380611 6:25230797-25230819 TCTGGGTCTTGTTCCCTTCAGGG - Intergenic
1005499414 6:26417088-26417110 TCTGGGTCCTGGTTTTCCCAGGG + Intergenic
1006144804 6:31952351-31952373 TCTGGGTCCTCTTGTCCCGGTGG + Exonic
1006155073 6:32009463-32009485 TCAGGGTCCTGGTGTCCACAGGG + Intergenic
1006161384 6:32042198-32042220 TCAGGGTCCTGGTGTCCACAGGG + Intronic
1006293335 6:33157772-33157794 TCTGAGTCCCTCTCTCCCCAGGG + Intergenic
1006898237 6:37484221-37484243 TGTCGGTTCTGTTCTCCCCTGGG - Intronic
1007419712 6:41712276-41712298 TCAGGGTCCTCTTCTACCCTGGG + Intronic
1008214289 6:48766552-48766574 TCTGGGTGTTTTTCACCCCATGG - Intergenic
1010928982 6:81777596-81777618 TCTTGCTCCTGTTCTTGCCATGG - Intergenic
1012132948 6:95519503-95519525 TCTGGGTCCTGGACTCCACAAGG + Intergenic
1016004638 6:139077065-139077087 TCTCTGTCCTTTTCTCCACATGG - Intergenic
1016941374 6:149485241-149485263 TCTGAATGCTGTTCTCCTCATGG - Intergenic
1017633541 6:156422404-156422426 TCTCTGTCCTTTTCTCCCCAGGG - Intergenic
1018090913 6:160346981-160347003 TCTCGGTCCCATTCTCCCCCAGG - Intergenic
1019449282 7:1088440-1088462 GCTGGGTGCTGCTCTCACCAGGG - Intronic
1020749547 7:12123321-12123343 TCTCAGTCCCATTCTCCCCAAGG + Intergenic
1022147509 7:27559751-27559773 TCTGTGGCCAGTTCTCCCCATGG + Intronic
1022269798 7:28795056-28795078 TGAGAGTCCTGTTCTCCGCAGGG - Intronic
1023590959 7:41780012-41780034 TCTGGGGCCTGCTCTGTCCAAGG - Intergenic
1024971514 7:55075665-55075687 TCTGGGTGCTGTCCTCACTACGG - Intronic
1028352132 7:89861936-89861958 TATGAGACCAGTTCTCCCCATGG - Intergenic
1029345535 7:99975957-99975979 TCTGGGTCCTGCTGTCCCCCAGG - Exonic
1029346250 7:99980814-99980836 TCTGGGTCCTGCTGTCCTCCAGG + Intergenic
1029558923 7:101289701-101289723 TCTGGGTCCTGCTATCCCCCAGG - Intergenic
1032127216 7:129203711-129203733 TTTGTGTCCTGTTGACCCCATGG - Intronic
1032467675 7:132156628-132156650 TCTTGGTCCTGTCCAGCCCATGG + Intronic
1032475946 7:132211580-132211602 CCTGGGCCCTGTTCTGCCCCTGG + Intronic
1035046822 7:155973271-155973293 TCAGGGCCCTGCCCTCCCCACGG - Intergenic
1038537977 8:28368207-28368229 TGTGAGGCTTGTTCTCCCCAGGG - Intronic
1038613955 8:29076112-29076134 TCTGGTTCCTTCTCTCCCCGAGG - Intronic
1039572934 8:38601636-38601658 GCTGGGACCTGTTCTCACCTGGG + Intergenic
1041388698 8:57330281-57330303 TAGGGGACCTGTCCTCCCCATGG - Intergenic
1041730074 8:61053925-61053947 TCTGGCTCCAGTCCTGCCCAAGG + Intergenic
1043823952 8:84902338-84902360 TCTTGGTGCTGTTCTCACAATGG - Intronic
1044692515 8:94894874-94894896 GCTGGGAACTTTTCTCCCCATGG + Intronic
1047799945 8:128298454-128298476 CCTGGGTCCTGCCCTGCCCAAGG - Intergenic
1048058858 8:130896556-130896578 TCAAGGTCCTGTTTTCACCATGG - Intronic
1048251626 8:132871036-132871058 TCTGAGTCCAGTTTTCTCCACGG - Intronic
1049397153 8:142406228-142406250 GCAGGGGCTTGTTCTCCCCATGG - Intergenic
1049901043 9:165539-165561 TCAGGGTGCTTTTCTCCCCAGGG + Intronic
1050402633 9:5272015-5272037 TCTCGGTGCTCTTCTCACCAAGG - Intergenic
1052858021 9:33418887-33418909 GGTGGGTGCTGTCCTCCCCAGGG + Intergenic
1053452266 9:38202970-38202992 TCTGGGTCCTTTTCATCCCTGGG + Intergenic
1053510211 9:38681165-38681187 TCTGGGTCCTGTAGACCCCAGGG + Intergenic
1053744077 9:41175854-41175876 CCAGGGTGCTTTTCTCCCCAGGG + Intronic
1054349353 9:64005657-64005679 CCAGGGTGCTTTTCTCCCCAGGG + Intergenic
1054483196 9:65689443-65689465 CCAGGGTGCTTTTCTCCCCAGGG - Intronic
1054684266 9:68255399-68255421 CCAGGGTGCTTTTCTCCCCAGGG - Intronic
1055829302 9:80360088-80360110 TCTGATTCCTGTTCAACCCACGG - Intergenic
1056398399 9:86203221-86203243 TCTCGGTCCCATTCTCCCCCAGG + Intergenic
1056616249 9:88168625-88168647 TCTGTGTTCTTTTCTCCCCATGG - Intergenic
1062181698 9:135194454-135194476 TCTGGATCTTCTTGTCCCCAGGG + Intergenic
1062238696 9:135524701-135524723 TCTGGGTTCAATTCCCCCCACGG + Intronic
1062361728 9:136191506-136191528 TCTGGGGCCTTTTCTGCCCAGGG + Intergenic
1062438345 9:136557021-136557043 TCTGGGTCCTGCCTTCTCCAGGG - Intergenic
1062441497 9:136571675-136571697 CCTGGTTCCTGTTCCCTCCAAGG - Intergenic
1203744658 Un_GL000218v1:35199-35221 TCTGTGTCCTATTTTTCCCATGG + Intergenic
1203565446 Un_KI270744v1:84285-84307 TCTGTGTCCTATTTTTCCCATGG - Intergenic
1186193148 X:7085805-7085827 TCTGAGTCTTTTTCTCCACAAGG + Intronic
1186638256 X:11428248-11428270 TCTCAGTCCTGCCCTCCCCAAGG - Intronic
1188375394 X:29422122-29422144 GATGGGTTCTGTTCTCCCTAAGG - Intronic
1190723031 X:53166830-53166852 TATGAGGCCAGTTCTCCCCAAGG - Intergenic
1190733564 X:53240436-53240458 TCTTGATCCTGTTCTCCCTGTGG - Intronic
1192378885 X:70593402-70593424 TTTGGGTACTGATCTCCCCATGG - Intronic
1194417922 X:93636529-93636551 ACTGGGTACTGTTCTCCTGAAGG + Intergenic
1195693668 X:107650420-107650442 TGTGTGACCAGTTCTCCCCAAGG + Exonic
1197157979 X:123291064-123291086 TCTGTGTCCTGTTTCCCTCAGGG - Intronic
1197164305 X:123359770-123359792 TATGGCTCATGTTCTCCCCTGGG - Intronic
1198920826 X:141724421-141724443 TCTGCTTCCTGTTCTCATCACGG + Intergenic
1199018208 X:142845177-142845199 TCTGGTTCCATTTCTACCCAAGG + Intergenic
1199358141 X:146885284-146885306 TCTGTGTCCTCTGCTCCCCTAGG + Intergenic
1199703130 X:150400164-150400186 TCTGAGTTCTGACCTCCCCAGGG - Intronic
1200846920 Y:7839729-7839751 TCTGGTTCATGTTCTTCCCCAGG + Intergenic