ID: 1069827395

View in Genome Browser
Species Human (GRCh38)
Location 10:71262504-71262526
Sequence GGACCCAGAGGAGCCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069827391_1069827395 -3 Left 1069827391 10:71262484-71262506 CCACTTCCTTGGGGAGAACAGGA 0: 1
1: 0
2: 1
3: 22
4: 240
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data
1069827392_1069827395 -9 Left 1069827392 10:71262490-71262512 CCTTGGGGAGAACAGGACCCAGA 0: 1
1: 1
2: 3
3: 41
4: 308
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data
1069827389_1069827395 2 Left 1069827389 10:71262479-71262501 CCAGGCCACTTCCTTGGGGAGAA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069827395 Original CRISPR GGACCCAGAGGAGCCCGCCC GGG Intronic
No off target data available for this crispr