ID: 1069831420

View in Genome Browser
Species Human (GRCh38)
Location 10:71284492-71284514
Sequence CAGGTAGAAGATGCATTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069831415_1069831420 10 Left 1069831415 10:71284459-71284481 CCACTTGTGCATTTTGGAGATGA 0: 1
1: 0
2: 2
3: 18
4: 202
Right 1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069831420 Original CRISPR CAGGTAGAAGATGCATTGGT GGG Intronic
No off target data available for this crispr