ID: 1069832825

View in Genome Browser
Species Human (GRCh38)
Location 10:71291511-71291533
Sequence TTTTGTCGGTGGAGTCCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069832825_1069832834 25 Left 1069832825 10:71291511-71291533 CCTGCAGGACTCCACCGACAAAA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1069832834 10:71291559-71291581 GGACCCCTTACCCAGCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1069832825_1069832831 4 Left 1069832825 10:71291511-71291533 CCTGCAGGACTCCACCGACAAAA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1069832831 10:71291538-71291560 CATGACCAACTCTCCTCTGCTGG 0: 1
1: 0
2: 3
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069832825 Original CRISPR TTTTGTCGGTGGAGTCCTGC AGG (reversed) Exonic