ID: 1069834111

View in Genome Browser
Species Human (GRCh38)
Location 10:71297833-71297855
Sequence CAGTCCAAGGGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069834103_1069834111 16 Left 1069834103 10:71297794-71297816 CCAGAGGAGGTGGGAGTGACTCA 0: 1
1: 0
2: 1
3: 23
4: 251
Right 1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG 0: 1
1: 0
2: 3
3: 52
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069834111 Original CRISPR CAGTCCAAGGGGAGGGAGGC TGG Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900554018 1:3270809-3270831 CAGTCCCAGGGGAGGAAAGTCGG + Intronic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
900972197 1:5997928-5997950 CAGCCCTAGAGGAGGGAGGTGGG - Intronic
900988338 1:6086189-6086211 CATTTCGAGGGGAGGGAGGAGGG - Intronic
901011219 1:6203537-6203559 TTGTACAAGGGGAGGGAGGGTGG - Intronic
901159370 1:7163322-7163344 GAGACCAAGGAGCGGGAGGCCGG + Intronic
902371274 1:16008553-16008575 GAGGCCAAGGAGGGGGAGGCGGG + Exonic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902837046 1:19054086-19054108 CAGTTAAAGGGGAGGGTGGCCGG - Intergenic
902860639 1:19242793-19242815 CTGTCCATTGGGAGGCAGGCAGG - Intronic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903164037 1:21508854-21508876 CAGCCCACGGGCAGGGAAGCGGG + Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
903906420 1:26690711-26690733 CAGACAAAATGGAGGGAGGCAGG - Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904048481 1:27623666-27623688 GAGTCCAAGGGGTCGGAGGCAGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
905381878 1:37567901-37567923 CAGGCCAAGGGGAGGCTGCCAGG + Intronic
905410619 1:37765585-37765607 CAGACCTAGGGCAGGGAGACAGG - Intergenic
905895407 1:41542663-41542685 CAGTGCAAGGGGATGATGGCAGG + Intronic
906581631 1:46940074-46940096 CCCTACAAGGGGAGGGGGGCGGG - Intronic
906676140 1:47694770-47694792 CTGTCCCAGGGGAGTGGGGCTGG - Intergenic
908089176 1:60668755-60668777 CTGTCCACTGGGAGGGAGGGAGG - Intergenic
909819747 1:80047028-80047050 CAGTTCCAGGGGAGAGAAGCAGG - Intergenic
910288263 1:85577312-85577334 CAAGCCAAGGGGATGGGGGCGGG + Intronic
910426179 1:87121934-87121956 CAATCCTAGGGGGTGGAGGCGGG - Intronic
912447618 1:109750021-109750043 GAGACCAAAGGCAGGGAGGCAGG - Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
913129781 1:115828872-115828894 GCGTCCCAGGGGAGGGGGGCAGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913524186 1:119675516-119675538 TGGTCGAAGGGGAGGGAGGCCGG + Intronic
914421592 1:147533095-147533117 CAGTCTAGGGGGAGGGAGAAAGG + Intergenic
914803193 1:150974853-150974875 CAGCCCAAGGGCCGGGAGGCTGG + Exonic
915267837 1:154731592-154731614 CAGTGCAAAGGGAGGGCCGCAGG - Intronic
915489047 1:156241469-156241491 CAGGCACAGGGAAGGGAGGCAGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916056560 1:161072632-161072654 CAGGCCTAGGGAAGGGAGGCAGG + Exonic
916505487 1:165424804-165424826 CAGTCCTGGGTGAGGAAGGCAGG + Intronic
918303961 1:183228916-183228938 CAATCCCAAGGCAGGGAGGCAGG + Intronic
918852125 1:189705964-189705986 GAGTCCAAAGGGAGGAAGTCAGG - Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920459505 1:206128426-206128448 GAGCCCAAGAGGTGGGAGGCTGG + Intergenic
921157793 1:212451918-212451940 CAGTGCAAGAGGTGGGAGGTGGG - Intergenic
922681952 1:227606219-227606241 CTCTCCAAGGGGAGTGTGGCAGG + Intronic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
923631363 1:235650641-235650663 CACTCCGGGGGGAGCGAGGCCGG + Intronic
924308893 1:242719787-242719809 AAGTCCAGGGGAAGGCAGGCAGG - Intergenic
1063068797 10:2637818-2637840 CAGTCAGAGGGGAGGCAGACTGG + Intergenic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1066460445 10:35608241-35608263 CAGGCCACGCGGAGGGACGCCGG + Exonic
1066517776 10:36183081-36183103 CAGTCCAATGAGAGAGAGGTGGG - Intergenic
1066724005 10:38371017-38371039 CTGCCCAAGGTGAGTGAGGCTGG - Intergenic
1067829941 10:49605783-49605805 CTGGCCAAGGGCAGGCAGGCAGG + Intergenic
1068274305 10:54773091-54773113 CTGTCCAAGGGGTGGGGGGCAGG + Intronic
1068739512 10:60452510-60452532 CAATCGAAGGGGAGGAAGACGGG - Intronic
1068783301 10:60944215-60944237 CAGGCGAAGGGGAGGGCTGCGGG - Exonic
1069578063 10:69544798-69544820 GAGTCGAAGGGGAGGGAGAGCGG - Intergenic
1069680789 10:70283866-70283888 CAGCCCGAGGGGAGGGAAACCGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069984235 10:72273077-72273099 CAGTCCGCGGGGAGGGCGGATGG + Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1071527527 10:86366855-86366877 CGGGCGGAGGGGAGGGAGGCGGG - Intergenic
1072761472 10:98060496-98060518 CACTCCAAAGAGTGGGAGGCGGG - Intergenic
1073065987 10:100759476-100759498 CAGCCAAAAGGGAGGGAGGCAGG + Intronic
1073544248 10:104335640-104335662 CAGTCCAGGTGGAGGAAGGAGGG - Intronic
1074166479 10:110881468-110881490 CAGTCCAAAGGGAAGGTTGCTGG + Exonic
1074507755 10:114086597-114086619 CTGACCCAGGGGAGGGAAGCTGG - Intergenic
1074832809 10:117261654-117261676 CAGCCCAACTGCAGGGAGGCAGG - Intronic
1075023207 10:118966225-118966247 AGGTGCCAGGGGAGGGAGGCTGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075194851 10:120347698-120347720 CACTGCCAGGGGATGGAGGCGGG - Intergenic
1075822803 10:125329155-125329177 CTGACCAAGGGAAGAGAGGCTGG - Intergenic
1076629775 10:131845614-131845636 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1076629795 10:131845701-131845723 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1076886348 10:133264452-133264474 CTTTCCCAGGGTAGGGAGGCTGG + Intronic
1077168058 11:1152575-1152597 AAGTCCAGGGGGCCGGAGGCGGG + Intergenic
1077183456 11:1226473-1226495 CAGTCCAGGGTGAGCCAGGCAGG + Intronic
1077302143 11:1852319-1852341 CAGCCCGAGGGGAGGGATGGAGG - Intergenic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1078096384 11:8299795-8299817 AGGTCAAGGGGGAGGGAGGCTGG + Intergenic
1078196051 11:9137994-9138016 CAGGCCCAGGGGATGGAGACAGG + Intronic
1079132430 11:17755153-17755175 CAGTGCAAGAGCATGGAGGCAGG + Intronic
1079735705 11:23994395-23994417 CAGTCCAAGGGCAGCAAGGGTGG - Intergenic
1080750693 11:35147542-35147564 CAGTCCACAGGAAGGGATGCAGG + Intronic
1081986204 11:47306172-47306194 CAGCCCAAGGGGAGTGGGGAGGG + Intronic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082997662 11:59266362-59266384 CTGTCCAAATGGAGGGTGGCAGG - Intergenic
1083891219 11:65596663-65596685 CAGTTCAGGGGCAGGGAGTCAGG - Intronic
1083891980 11:65600037-65600059 CAGTCCCAGTGGAGGCAGGCTGG + Intronic
1083951932 11:65961420-65961442 AAGTGCAAGCGCAGGGAGGCCGG + Intergenic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084113893 11:67030798-67030820 CTGTCCATGGGGAGGGCTGCAGG - Intronic
1084736896 11:71111256-71111278 CACTCCCTGGGGATGGAGGCAGG - Intronic
1085319385 11:75564756-75564778 GGGTCCAAGGGGAGGGAGGTGGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1088417461 11:109605485-109605507 CAGTCCTAGGGAAGTGAGTCTGG + Intergenic
1088698390 11:112389941-112389963 GAGTCCAAGAGGAAGGAGTCAGG - Intergenic
1088732207 11:112693644-112693666 CAGTCACAGGGGTGGGGGGCAGG - Intergenic
1089078920 11:115760366-115760388 CAGGCCGAGGGGGGGGCGGCGGG - Intergenic
1089164739 11:116466984-116467006 ACGTCCAAGGGGAGGGAGAAGGG - Intergenic
1089555743 11:119315259-119315281 CACACCTGGGGGAGGGAGGCGGG + Exonic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090363087 11:126186748-126186770 GAGTCCAAGAGGGGCGAGGCAGG - Intergenic
1090662077 11:128890030-128890052 CTGTCCCAGGGGAGGGTGCCTGG + Intergenic
1091227519 11:133966414-133966436 CATTCCAACAAGAGGGAGGCTGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1092162284 12:6322398-6322420 CACCCCAAGGGGAGGCAGGTGGG + Intronic
1092934343 12:13346776-13346798 TACTCCAAGGGGTGGGAAGCTGG - Intergenic
1093289520 12:17303190-17303212 CAGTCCAAGGGGAGGTATACAGG + Intergenic
1093934639 12:24987817-24987839 CAGTTATAGGGGAGGGAGGTGGG - Intergenic
1093962908 12:25294672-25294694 GAGTCCATGGGGAGGTAGGGTGG + Intergenic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1097448715 12:59709838-59709860 CAGCCTAAGGGGAGGAAAGCTGG - Intronic
1100021866 12:90078644-90078666 CTGCCCACGTGGAGGGAGGCAGG - Intergenic
1101536613 12:105623677-105623699 CAGTTCAAGGGGAGGAAAGGTGG + Intergenic
1101965715 12:109280614-109280636 CAATCCAGGGGGAAAGAGGCAGG + Intronic
1102520095 12:113472499-113472521 CAGGCCCAGGGTGGGGAGGCGGG + Intergenic
1102645562 12:114401365-114401387 CACTCCAAGGTCAGGGAGGGTGG + Intronic
1103362750 12:120363357-120363379 TAGTCCCTAGGGAGGGAGGCAGG - Intronic
1103601828 12:122059377-122059399 CTGTCCTTGGGGAGGCAGGCGGG + Exonic
1104062489 12:125280548-125280570 TAGGTCCAGGGGAGGGAGGCAGG - Intronic
1104092136 12:125526143-125526165 GAGGCCCAGAGGAGGGAGGCTGG - Intronic
1104915728 12:132263499-132263521 GAGCCCAGGGGGAGGGGGGCAGG + Intronic
1104983354 12:132583503-132583525 CCGTCCAAGGCGGGGGCGGCGGG - Exonic
1106874879 13:34060687-34060709 CAGTTCAGGGGGAGGGAAGAAGG - Intergenic
1107120172 13:36787489-36787511 CACTCCAGGGGGACTGAGGCTGG + Intergenic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1115128456 14:30024721-30024743 CCACCCAAGGGGAGGGAGGTGGG - Intronic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117791847 14:59349990-59350012 AAATCCAAGCTGAGGGAGGCTGG + Intronic
1118292570 14:64540137-64540159 CCGTCCAAGGGGAGGGAATAGGG - Intronic
1118819546 14:69336087-69336109 CAGCCCACGTGGAGTGAGGCAGG - Intronic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1119888230 14:78162332-78162354 CACTCCAGGAGGAGAGAGGCTGG + Intergenic
1120167384 14:81215913-81215935 TAGTCCCAGGGGTGGGAGGATGG + Intronic
1120836276 14:89040874-89040896 CAGTCCCGGGCCAGGGAGGCAGG + Intergenic
1121251263 14:92500955-92500977 AAGCCCAAGGGGATGCAGGCTGG + Exonic
1121275303 14:92663434-92663456 CAGGCAAGAGGGAGGGAGGCCGG + Intronic
1121293298 14:92794809-92794831 CAGCACAGAGGGAGGGAGGCTGG - Intronic
1121320622 14:92989673-92989695 CAGGCCTCGGGGAGGGAGGGAGG - Intronic
1121732021 14:96193804-96193826 CAGTCCTGGGGGAGGGGTGCTGG - Intergenic
1121857285 14:97281851-97281873 CAGTCCAAAAGCAGGCAGGCTGG + Intergenic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1122798447 14:104217990-104218012 CGGTCCCTGGGGAGGGAGTCAGG + Intergenic
1122849418 14:104519401-104519423 CAGTCCAAAGGGAGTGATGCAGG + Intronic
1123135360 14:106022707-106022729 CACCCCAAGGGCAGGAAGGCAGG + Intergenic
1123581532 15:21718941-21718963 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1123618181 15:22161564-22161586 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1123795085 15:23763143-23763165 CAGCCAAAGGGGAGGGTGGGGGG + Intergenic
1124373732 15:29117524-29117546 CAGCCAAGGGGGCGGGAGGCAGG - Exonic
1127724663 15:61737308-61737330 CAGCCCAGAGAGAGGGAGGCTGG - Intergenic
1128080765 15:64855536-64855558 AAGTGCAAGGGGAGGAAAGCTGG - Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128992520 15:72272575-72272597 CAGGCCAAGGGGCGGGGGCCGGG + Exonic
1129139686 15:73586149-73586171 AAGTCCAAGTGCAGAGAGGCAGG - Intronic
1129328648 15:74815578-74815600 CATTCCAAGGTGAGGAAAGCAGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129672134 15:77613322-77613344 CACTGCAAGGGGTGGGAGCCTGG - Exonic
1129882519 15:79016713-79016735 CAGTCCCAGAGGAGTAAGGCGGG - Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129964996 15:79726729-79726751 GACTCCAAAGGGAGGGAGGGAGG - Intergenic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1132610995 16:816314-816336 CAGTGCCAGGGGAGGGACACGGG - Intergenic
1132676768 16:1124287-1124309 CAGGCCAAGGGGAGAGAAGAGGG + Intergenic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1133025203 16:2986174-2986196 TAGCCCAAGAGGAGGCAGGCGGG - Intergenic
1133678132 16:8095197-8095219 CAGTTCAAAGGCAGGCAGGCAGG + Intergenic
1134213097 16:12294605-12294627 TAGGCAAAGGGCAGGGAGGCGGG - Intronic
1136088537 16:27902548-27902570 CAGAGCAAGGGGAGGGAGAGGGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136540043 16:30923913-30923935 CGGGCCCAGGGGAGGGGGGCAGG + Intronic
1136720567 16:32316595-32316617 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136838947 16:33522877-33522899 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136843959 16:33561049-33561071 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1137980080 16:53062022-53062044 CAGCCCCAGGGGTGAGAGGCGGG - Intronic
1139484252 16:67247196-67247218 CCGCTCAAGGTGAGGGAGGCCGG - Exonic
1139546854 16:67653540-67653562 CAGCCCCGGGGGAGGGAGGGAGG - Intronic
1139725464 16:68894036-68894058 CAGTCCAATGTGGAGGAGGCTGG + Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1141253746 16:82382082-82382104 GAGTCCAAGGTGAAGGTGGCAGG + Intergenic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141828155 16:86495146-86495168 CACACCCAGGGGTGGGAGGCCGG - Intergenic
1141832979 16:86520000-86520022 CAGGGCAAGGGGAGGCAGCCAGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1142211942 16:88812474-88812496 CGGACCCGGGGGAGGGAGGCCGG + Intergenic
1142272219 16:89096053-89096075 CAGCCCTCGGGGAGGGAGGCAGG - Intronic
1203005865 16_KI270728v1_random:201175-201197 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1203149110 16_KI270728v1_random:1823164-1823186 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1203154124 16_KI270728v1_random:1861348-1861370 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143449685 17:7028481-7028503 CACTCCAAGTGGAGGCTGGCAGG + Exonic
1143631413 17:8142474-8142496 CAGACCAATGGGAGTCAGGCCGG + Intronic
1143645005 17:8224239-8224261 GGGCCCAAGGGGAGGGAGACAGG - Intergenic
1143653123 17:8276636-8276658 CACTCTGAGAGGAGGGAGGCAGG + Intergenic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143888604 17:10085348-10085370 CAGGCCTAGGGGATGGAGGTGGG - Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144849258 17:18235777-18235799 CAGTCCCAGGGCAGGCAGGCTGG - Intronic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1145900467 17:28487647-28487669 TAGTCCAAGGGGAGGGTAACTGG + Intronic
1146059503 17:29596982-29597004 TCATTCAAGGGGAGGGAGGCAGG - Intronic
1146059525 17:29597072-29597094 CAGCCCACGAGGAGGAAGGCAGG - Intronic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146352261 17:32104555-32104577 CAGTTCAGGGGGAGGCAGGGTGG + Intergenic
1147318815 17:39633781-39633803 CAGGCCTACGGGAAGGAGGCTGG + Intronic
1147340444 17:39750542-39750564 CAGCCCAAGGGCAGGAAGGGTGG + Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147770751 17:42866455-42866477 CAGTACAAGGGGAGGCATGAAGG + Intergenic
1147909566 17:43847370-43847392 CAGCCCTAGGGGAGCGGGGCGGG + Intronic
1149409895 17:56394576-56394598 CAGTCCAGGGGTAGGGATGGTGG - Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149869765 17:60170893-60170915 CAGTTCAGGGGGAGGTAGGGTGG + Intronic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150041245 17:61863522-61863544 GAGTCGAGGGGGCGGGAGGCGGG - Intergenic
1150137175 17:62702410-62702432 AAGGCCAAGGGGCGGGGGGCGGG + Intronic
1150228947 17:63539385-63539407 CAGGCCCAGGGGAGGGTGTCAGG - Intronic
1150925311 17:69526435-69526457 AAGTCCAGGGGTAGGGGGGCAGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152184260 17:78844281-78844303 CAGTACCAGGGGAGCGATGCAGG - Intergenic
1152427416 17:80225748-80225770 CAGCCCTAGGGGAGGTGGGCGGG + Intronic
1152529192 17:80907065-80907087 AAGTCCACGGAGATGGAGGCGGG - Intronic
1152579670 17:81160356-81160378 CGGTCCCTGCGGAGGGAGGCTGG + Intronic
1152623498 17:81377885-81377907 CACTCCACAGGGAGGGAGCCAGG + Intergenic
1152681741 17:81671980-81672002 CAGCCCTATGGGAGGGAGGTGGG + Intronic
1152737377 17:82004182-82004204 GAAACCGAGGGGAGGGAGGCTGG - Intronic
1153189191 18:2519070-2519092 TAGTCCAAGGGGATGTAGTCTGG - Intergenic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1156270168 18:35523461-35523483 GAGGCCAAGGGGCGGGAGGGCGG - Intergenic
1156447886 18:37250412-37250434 CAGACCTAGGGGAGGGAGAAGGG - Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
1160865243 19:1253282-1253304 GGGCCCATGGGGAGGGAGGCAGG - Intronic
1160894065 19:1394657-1394679 CAGTCCGCAGGGAGGGAGGGAGG - Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161139568 19:2639648-2639670 CCATCCAAGGGGAGGGATTCAGG + Intronic
1161286541 19:3471307-3471329 AGGTCAGAGGGGAGGGAGGCTGG + Intergenic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1162144907 19:8607634-8607656 CAGCCCCAAGGGAGGGAGCCAGG + Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1163132150 19:15281217-15281239 TGGTCCAAGGGGTGGGGGGCAGG - Intronic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1163557731 19:18001992-18002014 CAGTCTAAGTTGAGGGAGTCTGG - Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163796500 19:19341156-19341178 CAGTCCCAGGGCAGGTGGGCAGG + Intronic
1164968692 19:32510851-32510873 CAGCCCAGGGGGAGGGAGTCAGG + Intergenic
1165094667 19:33403567-33403589 CTGTCCCATGGGAGGGAGCCAGG + Intronic
1165244875 19:34493127-34493149 CAGTGCCAGGGGTGGGAGGTGGG + Intronic
1165559473 19:36666869-36666891 CAGTCCGAGGGGAGAGCGCCTGG + Intergenic
1165751678 19:38264317-38264339 AAGCCCAAGGGAAGGGTGGCAGG + Intronic
1166256611 19:41610617-41610639 CAGTCAAAGAGTGGGGAGGCAGG - Intronic
1166813509 19:45527994-45528016 CAGTCCAAAGGCAGGAAGGAAGG + Exonic
1167005822 19:46775826-46775848 GATTCCAGGGGGAGAGAGGCAGG - Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167469048 19:49665327-49665349 CTGTCCTGGAGGAGGGAGGCGGG - Exonic
1168189855 19:54730027-54730049 CAGACCCAGAGGAGGGAGACTGG + Intronic
1168199846 19:54806482-54806504 CAGACCCAGAGGAGGGAGACTGG + Intronic
925851775 2:8088712-8088734 CATTCCAGAGGGAAGGAGGCAGG + Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926107652 2:10162511-10162533 CAGGCCAAGGAGAGTGTGGCCGG - Intronic
926289490 2:11517189-11517211 AAGGCAAAGGGCAGGGAGGCCGG - Intergenic
926699025 2:15790420-15790442 CAGTCCCAGGGGAGGTGGGCAGG - Intergenic
927312961 2:21651163-21651185 TAGTCGATGGGGAAGGAGGCAGG - Intergenic
927423747 2:22958419-22958441 CAGCCCAAGGCTAGGGAGGATGG + Intergenic
927699104 2:25256743-25256765 AAGTACAAGGGGAGTGTGGCAGG - Intronic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
931655047 2:64503110-64503132 CAGTTCAGGTGCAGGGAGGCTGG + Intergenic
932021896 2:68095888-68095910 CAGTCCAAGGGCCAGTAGGCAGG - Intronic
932703110 2:74004095-74004117 AAGTCCAAGAGCAGAGAGGCTGG + Intronic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
934714738 2:96536976-96536998 CGGGCCAAGGGGAGCGAGCCCGG + Intronic
934738871 2:96704725-96704747 CAGCCCAAGGGGAGGGCTGTTGG - Intergenic
935208860 2:100921253-100921275 CATTCCAAGGGGAAGGAGCGAGG - Intronic
937815277 2:126244253-126244275 CAGTACAAAGGGTTGGAGGCTGG - Intergenic
937917566 2:127106508-127106530 GAGGCCAAGGGCCGGGAGGCTGG - Intronic
937981721 2:127619788-127619810 GAGTCCATGGGGAAGGACGCAGG + Intronic
938665820 2:133535288-133535310 AACTCCAAAGGGAGGGAGGATGG - Intronic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
941543482 2:166816036-166816058 GAATCCAAGGAGAGGGAGGTGGG + Intergenic
942324824 2:174767157-174767179 CAGTCCAAGGGGAGATGGGGCGG - Intergenic
944415720 2:199477785-199477807 CAGTCCTAGGAAAGGGAGACAGG + Intergenic
944625784 2:201567555-201567577 CAGTCCAAAGGCTGGTAGGCTGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946124089 2:217544476-217544498 GAGTACAAGGGAAGAGAGGCTGG + Intronic
946131345 2:217609446-217609468 GAATCCAAGGGGAAGGAGGAAGG + Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946295751 2:218782276-218782298 TTGTCCGAGGGGAGGGCGGCAGG - Exonic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946410015 2:219511106-219511128 GGGTGCAGGGGGAGGGAGGCTGG + Intergenic
946642802 2:221802379-221802401 CTCTCCAAGGGGAGAAAGGCAGG - Intergenic
947590685 2:231383386-231383408 TAGGCCAGGGGGACGGAGGCAGG - Intergenic
947944768 2:234092105-234092127 CAGTCCAAGTGAGGGGAAGCAGG - Intergenic
948330428 2:237160390-237160412 GAGTCCCAGGGGAGTGAGGGAGG + Intergenic
948379280 2:237541598-237541620 CTGTTCAAGGGGAGCGAGTCAGG + Intronic
948804551 2:240447830-240447852 CACTCCATGGGGAGGGAGGAAGG + Intronic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
1169521696 20:6380486-6380508 TAGCCAAAGGGGAGGGTGGCAGG + Intergenic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171385261 20:24765580-24765602 GAGTCCCAGGGGAGCTAGGCAGG - Intergenic
1172486407 20:35300601-35300623 CTGACCTGGGGGAGGGAGGCAGG + Intergenic
1172640380 20:36437021-36437043 CAGCCGAATGGGAGGAAGGCGGG - Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173186051 20:40841136-40841158 CCCTCCAAAGGGTGGGAGGCTGG + Intergenic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1174203514 20:48823508-48823530 CAGTCCAAGTGGAAGAAGCCTGG + Intronic
1175014753 20:55777561-55777583 CAGTCCTAGGGGTAGGAGGGGGG + Intergenic
1175146668 20:56901684-56901706 CAGTCCTAGAGGACGGAGGATGG - Intergenic
1175154827 20:56963615-56963637 CAGTCCAATGGGAGAGAAGATGG + Intergenic
1175273253 20:57749488-57749510 CAGTGCAAGGGCAGGAAGGCAGG + Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1175825407 20:61934038-61934060 TAGTCCTGGGGGAGGGAGCCGGG - Exonic
1176061195 20:63173679-63173701 CAGTGCATGGCCAGGGAGGCTGG + Intergenic
1176231525 20:64035683-64035705 CAGCCCAGGAGGAGTGAGGCCGG + Intronic
1176305630 21:5121673-5121695 CAGGCCTCGGGGAGGGAGGGAGG - Intronic
1178319014 21:31590824-31590846 GAGGCCAAGGGGTGGGGGGCGGG + Intergenic
1179395509 21:41036476-41036498 AAGCCCAAGGGGAAGGAGACAGG + Intergenic
1179647872 21:42786223-42786245 CAGGCCAAGGCGAGGCAGGTGGG + Intergenic
1179802819 21:43819490-43819512 CAGTCCCAGGGGAGAGAGGAGGG + Intergenic
1179851427 21:44140358-44140380 CAGGCCTCGGGGAGGGAGGGAGG + Intronic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1179961122 21:44767377-44767399 CACGCCCAGGGGAGGGAAGCTGG + Intergenic
1180055399 21:45356432-45356454 CAGTCTAAGGGGATGCTGGCAGG - Intergenic
1180144676 21:45912627-45912649 CAGTCCCAGGGGAGGCCAGCAGG + Intronic
1180308508 22:11149624-11149646 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180546985 22:16511437-16511459 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180586060 22:16892352-16892374 CTGTCAAGGGGGTGGGAGGCTGG - Intergenic
1180651998 22:17385450-17385472 AAGCCCAAGGAGAGGGAGACAGG + Intronic
1181006482 22:20016171-20016193 CAGCCCGAGGGGCGGCAGGCCGG - Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1182772293 22:32804287-32804309 CTGTGCAAGGCGAGGGAGGTCGG - Intronic
1183293179 22:37015209-37015231 CCCTGCAAGGGGAGGCAGGCAGG - Intronic
1183403470 22:37618372-37618394 CTGTCCAAGGCGTGGGAGGGAGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183591652 22:38782638-38782660 AAGCCCCAGGGGAGGGAGGCAGG - Intronic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1184135919 22:42549863-42549885 CAGCCCAGGGGGTGGGAGGTGGG + Intergenic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184543694 22:45150338-45150360 CAGGCCAGGGGGAGGGAGAGAGG - Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185140842 22:49100482-49100504 CAATCCACGGCCAGGGAGGCCGG + Intergenic
1185288733 22:50013797-50013819 CGGTCCCAGGGGAGGGAAGGCGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
949190840 3:1246818-1246840 GAAACCAAGGGGAGGGAGGGAGG - Intronic
949697474 3:6715798-6715820 CAGTCCCAGGGGACTGAGGCAGG - Intergenic
949874700 3:8618580-8618602 CAGGCCTAGTTGAGGGAGGCTGG - Intergenic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
949940576 3:9151276-9151298 CAGCCCAAGGGCACGGAGGTGGG + Intronic
950439908 3:13004533-13004555 TAATCCAAGGAGAGGGAGGAGGG - Intronic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
950548371 3:13652480-13652502 CAGTTCATGAGGAGGGGGGCGGG - Intergenic
950610837 3:14125590-14125612 CAGTCCCTTGGGAGGGAGGAAGG + Intronic
950640270 3:14344087-14344109 CAGGCCAGGGGCAGGGAGGGAGG + Intergenic
950674768 3:14548114-14548136 CACTCAAAGGTGAGGTAGGCAGG + Intergenic
950690615 3:14652896-14652918 CCGTCTAAGGGGCGGGGGGCGGG + Intronic
951948884 3:28175734-28175756 CAGTTCAAATGGATGGAGGCTGG - Intergenic
952878989 3:37971286-37971308 TAGACCTGGGGGAGGGAGGCAGG + Intronic
952979044 3:38720599-38720621 CAGTCCCAGGGGAAGGAGATGGG + Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953572363 3:44081275-44081297 CAGTGCAAGCGGAGAGAGACAGG + Intergenic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953827646 3:46267936-46267958 CATCCCAAGGGGAGAGAGGAGGG + Intergenic
954116664 3:48470389-48470411 CAGCCCCAGGGCAGGGAGGCTGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
954928292 3:54256968-54256990 CAGTCCAAGTGGATGAAGGAAGG - Intronic
955170403 3:56558154-56558176 CAGTCAAGGGAGAGAGAGGCTGG - Intronic
955376100 3:58398475-58398497 CAGACCTAGGGCAGGCAGGCAGG + Intronic
955576728 3:60373244-60373266 CAGTCCTTGGGTGGGGAGGCTGG + Intronic
958807880 3:98833876-98833898 AAGTCCCAGTGAAGGGAGGCTGG + Intronic
958932538 3:100223085-100223107 AAGTCCAAGAGTAGTGAGGCTGG - Intergenic
960070234 3:113421827-113421849 GATTCCAAAGGGAGGGAGGGAGG + Intronic
961433254 3:126898160-126898182 CAGTCCAGGGGGTGCGAGCCGGG - Intronic
961488144 3:127231971-127231993 CTGGCCAAGGGGAGAGAAGCAGG - Intergenic
961491767 3:127261351-127261373 AAGTCACAGGGGAAGGAGGCAGG - Intergenic
961638936 3:128352690-128352712 GAGTCCTAAGGGAGGGAGACTGG + Intronic
964758504 3:160111026-160111048 CAGTTACTGGGGAGGGAGGCAGG - Intergenic
966340608 3:178921717-178921739 CAGTCTAAGTGCATGGAGGCTGG - Intergenic
966837184 3:184058411-184058433 CTGTCCACTGGAAGGGAGGCCGG - Exonic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
967911480 3:194545930-194545952 CAGTCCACGTGGTGGGAGGGTGG - Intergenic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970173024 4:13308100-13308122 AAGTACAAGGGGTGGGAGGTGGG - Intergenic
970476533 4:16429449-16429471 GATTCCAAAGAGAGGGAGGCAGG - Intergenic
972497254 4:39645492-39645514 AATTCCAAGGGGAGGGTGGGAGG - Intergenic
972696871 4:41455355-41455377 CAGTCCAGGGGCAGAGAGGGTGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
977574597 4:98662915-98662937 GAGCCCAAGAGGAGGGAGGCAGG - Intergenic
977942514 4:102874322-102874344 CTGCTAAAGGGGAGGGAGGCAGG + Intronic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
983798893 4:171902621-171902643 CAGTGAGAGGGTAGGGAGGCTGG + Intronic
985587963 5:750737-750759 CAGCCCATGGGGAGGGAGAGTGG - Intronic
985602632 5:843204-843226 CAGCCCATGGGGAGGGAGAGTGG - Intronic
986811867 5:11368427-11368449 CAGTCCTATGGCAGGGAGGGAGG + Intronic
987346936 5:16987261-16987283 CAGACCTAGGGGAGAAAGGCCGG - Intergenic
991438259 5:66618115-66618137 CAAGCCAACGGGCGGGAGGCCGG - Intronic
991593256 5:68276443-68276465 CATTCCAGGGGGAGGGAGGGAGG + Intronic
991918119 5:71625046-71625068 AAGACCAAGATGAGGGAGGCAGG - Intronic
993094999 5:83471518-83471540 GAGTGCCTGGGGAGGGAGGCAGG + Exonic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
997412949 5:133704042-133704064 CTGTCCTAGGGGTGGGAGGGTGG + Intergenic
998193180 5:140043629-140043651 CAGCCCAAGAGGCGAGAGGCTGG - Intergenic
999777624 5:154823593-154823615 CTGCCCAAGGGAAGGGAGGAGGG + Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000632191 5:163603250-163603272 CAGTCAAGGGGGAAGGATGCTGG + Intergenic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001270993 5:170311614-170311636 CACTCCCCTGGGAGGGAGGCGGG + Intergenic
1001586553 5:172836729-172836751 CATTCCAAGAGAAGGGAGGAGGG + Intronic
1002065678 5:176650556-176650578 CAGGCCAAGTGGGAGGAGGCAGG + Intronic
1002426720 5:179181025-179181047 CACTCCGAGGGGGTGGAGGCAGG + Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004511269 6:16286116-16286138 CTGTCCAAGGGGATGGTGCCAGG + Intronic
1005042238 6:21609983-21610005 GAGCCCAAGGGGAGGGGGGTAGG + Intergenic
1006026483 6:31150377-31150399 CTGCCCACAGGGAGGGAGGCAGG + Intronic
1006113563 6:31763259-31763281 GAGGGCAAGGGGAGGCAGGCGGG - Intronic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008336753 6:50315549-50315571 CAGTACCAGGGGAGGGAGAGAGG + Intergenic
1008344082 6:50404856-50404878 CACTCCAGGGGGAGGGAGGGTGG - Intergenic
1011044681 6:83068038-83068060 CGGCCCCAGGTGAGGGAGGCCGG + Intronic
1012266211 6:97146446-97146468 CAGTCACAAGGCAGGGAGGCAGG + Exonic
1013354137 6:109332467-109332489 CAGCTCAAGGGGAGAGAGGCTGG - Intergenic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1015416789 6:132958161-132958183 TAATCCAAGGGGAGGAAGGATGG + Intergenic
1015682795 6:135826264-135826286 CAGTTGAAGGGGGGGAAGGCAGG + Intergenic
1015943573 6:138476489-138476511 GACTCCAAAGGGAGGGAGGATGG + Intronic
1015966315 6:138698254-138698276 CAGTACAGGAGGAGGGAGACAGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016289019 6:142507149-142507171 GATTCCAAGGGAAGAGAGGCTGG + Intergenic
1017813248 6:157999389-157999411 CAGGCTAAGGGGAGGGAGACAGG - Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1019108578 6:169690741-169690763 CAGTCAAGGGGCTGGGAGGCAGG - Intronic
1019404927 7:877960-877982 AAGGCCAGGAGGAGGGAGGCAGG - Intronic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019596124 7:1859184-1859206 CACACCAGGGGGAGGCAGGCTGG - Intronic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019709033 7:2510006-2510028 CAGGCCAAGGGGTGGGCAGCTGG - Intergenic
1019812224 7:3173159-3173181 TGGGCCAAGGGGAGAGAGGCAGG + Intronic
1020739487 7:11995939-11995961 CAATACAAGAGGAGGGAGGAAGG - Intergenic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1022139080 7:27476497-27476519 CATTCAAAAGGGAGGGAGGGAGG + Intergenic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1022644178 7:32215547-32215569 GAGACCAATGGGAGGGAGGCAGG + Intronic
1023230528 7:38023122-38023144 CAGTCCAAGGGGGCTGAGGCAGG - Intronic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023754932 7:43407655-43407677 CTGTCCATGGTGAGGGAGGGCGG - Exonic
1024626927 7:51215830-51215852 AGGTGCAAGGGAAGGGAGGCTGG - Intronic
1025078472 7:55963324-55963346 CAGTCCCAGGGGAAGAAGGGAGG - Intronic
1026653414 7:72235677-72235699 GAGTCCAAGGTTAGGGGGGCGGG - Intronic
1026773118 7:73214434-73214456 CTGTCCAAGGGGATGGATCCTGG + Intergenic
1027013980 7:74767830-74767852 CTGTCCAAGGGGATGGATCCTGG + Intergenic
1027074057 7:75178202-75178224 CTGTCCAAGGGGATGGATCCTGG - Intergenic
1027420366 7:78012485-78012507 CAGCCCAAGGGGAGGGAGCTGGG - Intergenic
1028174144 7:87634015-87634037 GAGTCAAAGGGGAAGCAGGCAGG + Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029550112 7:101232941-101232963 CAGTCCAGGGGGAGGGATAGTGG + Intronic
1029941554 7:104485767-104485789 CTGTCAGAGGGGTGGGAGGCTGG - Intronic
1032171059 7:129584936-129584958 CAGTCCAAGGGGAGGTCCACAGG + Intergenic
1034057278 7:148048487-148048509 CAGTCCAATGGCAGGGAGGCTGG + Intronic
1034191719 7:149218243-149218265 CAGACCAAGTGGAGAGATGCTGG + Intronic
1034448132 7:151123692-151123714 CTGCCCAGGAGGAGGGAGGCAGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1036621649 8:10427983-10428005 CATTCCAAGTGGAGTGACGCTGG - Intronic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1039516035 8:38134411-38134433 AAGTCCAAAGGGAGGGAACCTGG + Intronic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1040874221 8:52133413-52133435 TAGTTCACGTGGAGGGAGGCGGG + Intronic
1040896500 8:52374017-52374039 CAGTCCACTGAGAGAGAGGCAGG - Intronic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1042182468 8:66105228-66105250 CCTTCAAAGGGGAGGTAGGCTGG + Intergenic
1044087570 8:87958999-87959021 CAGTCCACAGGGAGAAAGGCTGG + Intergenic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1044725532 8:95191545-95191567 GAGGCCAGGGGGAGGGAAGCAGG - Intergenic
1045132972 8:99178298-99178320 CATTTCAAGGGGAGGGGGGAGGG - Intronic
1045213717 8:100125791-100125813 CAGTCCATGCTGAGGGAGCCAGG + Intronic
1045367880 8:101493436-101493458 CGGACCCGGGGGAGGGAGGCGGG - Intronic
1047958555 8:129994326-129994348 CAGTCCAAGGCGAAGGTGCCGGG - Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048733485 8:137470994-137471016 CAGGCCAAGGCCAGGGAGACTGG + Intergenic
1049215472 8:141405881-141405903 CAGTGCAAGGGCTCGGAGGCAGG + Intronic
1049266809 8:141671936-141671958 CCCTCCCAGGAGAGGGAGGCAGG - Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049414001 8:142487229-142487251 CAGGCGAAGGGGTGGGAGGCTGG - Intronic
1049501914 8:142971557-142971579 GAAGCCTAGGGGAGGGAGGCTGG - Intergenic
1049750723 8:144282414-144282436 CAGGCCCAAGGCAGGGAGGCTGG + Intronic
1050633014 9:7580656-7580678 CAGTCCATGGGGAGATAGGAAGG + Intergenic
1051196206 9:14565150-14565172 CAGCCCCAGTGGTGGGAGGCAGG + Intergenic
1051730657 9:20139466-20139488 TAGTCAAAGGGGAGAGAGCCCGG - Intergenic
1052511720 9:29430659-29430681 CAGTTCATGGGGTGGGAGTCAGG - Intergenic
1052595193 9:30549038-30549060 CAGGCCAATGGGTGGCAGGCTGG + Intergenic
1052758720 9:32567799-32567821 CAGTCCAAGGAGAGGGAGAGAGG - Exonic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1053164471 9:35834957-35834979 CAGACAATGGGGTGGGAGGCAGG - Intronic
1053382131 9:37657864-37657886 AGGTCCAAGCAGAGGGAGGCTGG - Intronic
1053632540 9:39958773-39958795 GAGTGAAAGGGAAGGGAGGCAGG - Intergenic
1054211348 9:62291924-62291946 GAGTGAAAGGGAAGGGAGGCAGG + Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1058945546 9:109852257-109852279 CATTCCAAAAGGAGGGAGGAAGG - Intronic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1060001611 9:119963914-119963936 CAGCCCGAGGGGAGGCAGCCAGG - Intergenic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060396189 9:123318687-123318709 CAGCCCAAGGGGAGGCATGGGGG - Intergenic
1060718353 9:125955535-125955557 TGGTCCAGGGAGAGGGAGGCAGG + Intronic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1061080224 9:128365352-128365374 TAGTCCAAGGGGAGGCAGTGAGG + Intergenic
1062389183 9:136327362-136327384 CAGTCCCCGGGGAGGGGGGAGGG - Intergenic
1062396490 9:136354915-136354937 CAGGCCAAGGCTGGGGAGGCTGG + Intronic
1062453457 9:136625097-136625119 CAGACCAAGGTGGGAGAGGCCGG - Intergenic
1062686603 9:137816943-137816965 CAGGCCTGGGGGAGGGTGGCCGG - Intronic
1062716640 9:138013831-138013853 CAGTCCCTGGGAAGGGAGGCAGG + Intronic
1062725309 9:138070012-138070034 CTGCCCAAGGAGAGGGAGGTGGG + Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1188770599 X:34148623-34148645 CAGTTCAGGGGGAGAGTGGCTGG + Intergenic
1189328682 X:40129628-40129650 CAGTCCAGACGGAGGGAGGGAGG + Intronic
1189515126 X:41705887-41705909 CAGACCACGGGGAGGGGTGCCGG - Intronic
1190126821 X:47712970-47712992 CAGACCAGGGGCGGGGAGGCCGG + Intergenic
1192238928 X:69314478-69314500 CAGGCAAGGGGGAGGGAGGGTGG - Intergenic
1192865942 X:75132188-75132210 CAGTCCGAGGGCAGCAAGGCCGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193396496 X:80990173-80990195 CACTGCAAGGGGATGGAGGACGG - Intergenic
1194122372 X:89976616-89976638 CACTGCAAGGTAAGGGAGGCAGG + Intergenic
1194684304 X:96893713-96893735 CAGTCCAAGGGGAGAGCCTCAGG - Intronic
1195449133 X:104990380-104990402 CATCCCAAGGGGAGAGAGGGTGG - Intronic
1196869053 X:120095934-120095956 CAATGACAGGGGAGGGAGGCAGG + Intergenic
1198073983 X:133177320-133177342 CTGTCCAAGGGGACAAAGGCAGG + Intergenic
1198518148 X:137428549-137428571 CAGCCCGGGGGGAGGGGGGCTGG + Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1199803401 X:151273295-151273317 CTGTCCCAGTGGAGGGAGACAGG + Intergenic
1200002515 X:153069344-153069366 AGGTCCAAGGGCAGAGAGGCAGG + Intergenic
1200005209 X:153080666-153080688 AGGTCCAAGGGCAGAGAGGCAGG - Intergenic
1200105585 X:153710240-153710262 CAGGCCAAAGGGGGGAAGGCAGG + Intronic
1200475232 Y:3634055-3634077 CACTGCAAGGTCAGGGAGGCAGG + Intergenic