ID: 1069835443

View in Genome Browser
Species Human (GRCh38)
Location 10:71305069-71305091
Sequence TCCCCACCCCACTCCCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069835432_1069835443 27 Left 1069835432 10:71305019-71305041 CCCTCCTTCCTCTGTCTCTACTT No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835436_1069835443 -2 Left 1069835436 10:71305048-71305070 CCTCTCCACCCCTGTCCCTAGTC No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835437_1069835443 -7 Left 1069835437 10:71305053-71305075 CCACCCCTGTCCCTAGTCCCCAC No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835438_1069835443 -10 Left 1069835438 10:71305056-71305078 CCCCTGTCCCTAGTCCCCACCCC No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835433_1069835443 26 Left 1069835433 10:71305020-71305042 CCTCCTTCCTCTGTCTCTACTTC No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835434_1069835443 23 Left 1069835434 10:71305023-71305045 CCTTCCTCTGTCTCTACTTCATT No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data
1069835435_1069835443 19 Left 1069835435 10:71305027-71305049 CCTCTGTCTCTACTTCATTTTCC No data
Right 1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069835443 Original CRISPR TCCCCACCCCACTCCCATAG AGG Intergenic
No off target data available for this crispr