ID: 1069837584

View in Genome Browser
Species Human (GRCh38)
Location 10:71319124-71319146
Sequence CGCGCCGGGGCTCCCCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069837584_1069837594 24 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837594 10:71319171-71319193 CGTGTTTGCAAACGGGGAAGCGG 0: 1
1: 0
2: 2
3: 3
4: 65
1069837584_1069837593 18 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837593 10:71319165-71319187 AAAAAGCGTGTTTGCAAACGGGG 0: 1
1: 0
2: 0
3: 2
4: 114
1069837584_1069837595 27 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837595 10:71319174-71319196 GTTTGCAAACGGGGAAGCGGCGG 0: 1
1: 0
2: 0
3: 15
4: 203
1069837584_1069837591 16 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837591 10:71319163-71319185 GAAAAAAGCGTGTTTGCAAACGG 0: 1
1: 0
2: 1
3: 41
4: 346
1069837584_1069837592 17 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837592 10:71319164-71319186 AAAAAAGCGTGTTTGCAAACGGG 0: 1
1: 0
2: 2
3: 67
4: 739
1069837584_1069837589 -6 Left 1069837584 10:71319124-71319146 CCAGAAGGGGGAGCCCCGGCGCG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1069837589 10:71319141-71319163 GGCGCGCCGGCAGAAGACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069837584 Original CRISPR CGCGCCGGGGCTCCCCCTTC TGG (reversed) Intergenic
900135413 1:1115403-1115425 CGCGCCGGTGCCCCCACTCCCGG + Intronic
900349394 1:2227648-2227670 GGCGCCCGGGGCCCCCCTTCCGG - Intergenic
900384305 1:2402582-2402604 CTCGCCGGGGCTCTCCCACCCGG - Intronic
900471037 1:2855070-2855092 CGTGCCCTGGCTCCCCCTCCCGG + Intergenic
900516665 1:3085432-3085454 CCCCCCAGGGCTCCCCATTCTGG + Intronic
901787753 1:11635944-11635966 CCGGCCGGGGCTCTTCCTTCAGG + Intergenic
901876936 1:12172203-12172225 GGCGCTGTGGCTCCCCGTTCTGG + Intronic
903700815 1:25247110-25247132 CGCGCCGTGGCTCCGCCTCCCGG - Intronic
906411788 1:45584512-45584534 CGCGCCAGGGCCCCGCCTCCCGG - Intronic
906978688 1:50604756-50604778 AGCTCCTGGGCTCCCCCTTTTGG + Intronic
911079030 1:93909656-93909678 CGCGGCAGGGCTCCCCCTGGCGG + Intergenic
915440494 1:155942642-155942664 CCTGCCGGGGCTCCCGCCTCAGG - Exonic
919916716 1:202143939-202143961 AGGGCCGGGGCTTCCTCTTCCGG + Intronic
922155583 1:223037978-223038000 CTCGCCGGGGCTCCACCCTCAGG - Intergenic
924362381 1:243255061-243255083 CGCGCCCCGCCTCCCCCGTCCGG - Intronic
1069837584 10:71319124-71319146 CGCGCCGGGGCTCCCCCTTCTGG - Intergenic
1072294244 10:93994051-93994073 CGCGCCCGGGCTCTACCTCCCGG + Intronic
1077007372 11:364612-364634 CGTGCTGGGGCGCCCACTTCGGG - Intergenic
1077124312 11:925705-925727 GGCGCGGGGGCGCCCCCTGCAGG - Intronic
1078468715 11:11570082-11570104 CAGTCCGGGGCTCCGCCTTCTGG - Intronic
1083763238 11:64830041-64830063 CGCGCCGGCACTCCCCCACCTGG + Exonic
1084192269 11:67504583-67504605 AGCCCCGGGGCCCCTCCTTCCGG + Intronic
1086322420 11:85664660-85664682 GCCGCCGCGGCTCCCCCTCCCGG + Exonic
1089216201 11:116836170-116836192 CGCGCAGCGGCTCCACCTTCTGG + Exonic
1095766957 12:45907021-45907043 AGCGCCAGGGATCCTCCTTCAGG - Exonic
1101144786 12:101830841-101830863 CGCGCCGCGGCCGCCGCTTCCGG + Exonic
1102150823 12:110688469-110688491 TTCCCCGGGGCTCCTCCTTCAGG + Exonic
1102375672 12:112419192-112419214 CCGGCCGGGGCGCCCCCTTCCGG - Intronic
1103270218 12:119667722-119667744 CGCGCTGGGGTGCCCCCTGCCGG + Intergenic
1103381223 12:120495853-120495875 CCGGCCGGGGCTCCACCTTCTGG + Intronic
1104617288 12:130281358-130281380 TGCGCAGCGGCTCCCCCTGCCGG - Intergenic
1104979626 12:132568034-132568056 GACGCCGGGGCTACCCCCTCTGG - Intronic
1105539015 13:21298355-21298377 CGAGCTGGTGCTCACCCTTCGGG - Intergenic
1107931472 13:45311219-45311241 GGCGCCCGGGCGCCCCCTCCCGG + Intergenic
1108676036 13:52738961-52738983 CGCGCTCGGGCTCCCCCTAGGGG + Intronic
1113493667 13:110712525-110712547 CGCGCCGGCCCCCCCCCTTCCGG - Intronic
1113666038 13:112142685-112142707 AGCCCCGGGACTCCCCTTTCCGG - Intergenic
1113903995 13:113811107-113811129 CGGGCTGGGGCTGCTCCTTCTGG + Intronic
1118593929 14:67421497-67421519 CAGGCCAGGGCTCCTCCTTCTGG + Intergenic
1121774971 14:96584444-96584466 CGCTCCGGGGCTCCCTCAGCCGG - Intergenic
1122624238 14:103075900-103075922 CGCCCCGGGGCTGCCCCTGTGGG + Intergenic
1122908749 14:104816016-104816038 CGCGCCTGCGCACCCCCTCCCGG + Intergenic
1123734781 15:23175141-23175163 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124285283 15:28396443-28396465 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124297413 15:28515183-28515205 CTCGCCGGGCCTCCGCCTCCCGG + Intergenic
1129538100 15:76330476-76330498 CCAGCCTGGGTTCCCCCTTCTGG + Intergenic
1131455646 15:92580480-92580502 CCTGCCTGGGCTCCCCCATCAGG + Intergenic
1144339748 17:14301689-14301711 CGCGCCGGGGCTGCTGCTCCTGG + Exonic
1144433175 17:15213874-15213896 CAAGCAGGGGCTCCCCCTGCTGG + Intergenic
1144812087 17:18006976-18006998 CGCGCCGGGCCTGCTCCTCCCGG + Intronic
1145795868 17:27655102-27655124 GGAGCCGGGGCTCCCTCTCCTGG - Intergenic
1146794298 17:35770297-35770319 TGCGCCAGGGCGCCCCCTGCAGG + Exonic
1147157701 17:38552505-38552527 GGCGCTGGGGCTCCTCCTTCAGG + Exonic
1148038812 17:44689833-44689855 CGGGCCTGGGCTTCCTCTTCAGG - Intronic
1150069677 17:62140165-62140187 GGAGCCGGGGCTCCACCTGCAGG + Intergenic
1160672035 19:370054-370076 CGCACCTGGGCTCCCACTCCCGG + Intronic
1160728547 19:629863-629885 GGAGCCGGGGCTCCACCTGCAGG + Exonic
1162395630 19:10416828-10416850 TGCCCCAGGGCTCCCCCTGCCGG - Intronic
1163757249 19:19113447-19113469 CACGCAGAGGCTCCCACTTCTGG - Intergenic
1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG + Intergenic
1167019061 19:46860998-46861020 CGCGCCGCGGCTCTCCCTCGGGG - Intergenic
1168724876 19:58575604-58575626 CGCGCTGGGGCCCCGGCTTCGGG + Intergenic
929075721 2:38077224-38077246 CGCGCCCGGGCTCGGCCTGCGGG - Intronic
938368833 2:130756249-130756271 GGCGCCGGGCCTCCCCCTCCCGG + Intronic
942446075 2:176079981-176080003 CGCCCCGGGGCGCCCCCTGGCGG + Exonic
942453312 2:176121984-176122006 CGCGCCCCGGCTCGCCCCTCGGG + Intergenic
944415053 2:199471616-199471638 CCCGCGGCGGCTCCCCCTACCGG - Intergenic
945251400 2:207768800-207768822 CGGGCCGGGGCTTCTCCCTCCGG + Exonic
1170986640 20:21265338-21265360 AGGCCCGGGGCTCCTCCTTCAGG - Intergenic
1171041465 20:21767796-21767818 CGCACAGCGGCGCCCCCTTCTGG + Intergenic
1172383599 20:34516681-34516703 CGAGGCTGGGCTCCCGCTTCCGG - Intronic
1172534831 20:35664931-35664953 CACGCCGTTCCTCCCCCTTCTGG - Intronic
1173820168 20:46014294-46014316 GGCGCCCGGGCTCCCCCTGCCGG - Intronic
1173866705 20:46317073-46317095 CGAGCCCGGGCTCCCCACTCAGG - Intergenic
1174343763 20:49915048-49915070 CGCGCAGGGGTTCCCAGTTCAGG - Intronic
1175943794 20:62549711-62549733 GGCTCAGGAGCTCCCCCTTCCGG - Intergenic
1177751002 21:25283911-25283933 TGCACTGAGGCTCCCCCTTCTGG - Intergenic
1179054322 21:37916892-37916914 CGCGCCGGGGCTGCCTCTCACGG - Intergenic
1179607307 21:42525101-42525123 CTCGCCAGGGCTCCACCCTCCGG - Intronic
1184950951 22:47842308-47842330 CGCTGCAGGGCTCCACCTTCAGG - Intergenic
1185182170 22:49369789-49369811 CAGGCCTGGGCTGCCCCTTCAGG - Intergenic
950024302 3:9810059-9810081 GGCGCCGGGGCTCGGCCTCCTGG + Exonic
950510137 3:13420726-13420748 CGAGCCCGGGGTCCCTCTTCTGG - Intergenic
950552777 3:13676757-13676779 CCAGTCGGGGCTCCCCCTCCAGG - Intergenic
958641830 3:96814756-96814778 CGCCCCGGGACACCCCCTGCGGG + Exonic
960702231 3:120450462-120450484 CGCGGCGGGGCTCCCGCTTACGG + Intronic
967054809 3:185823294-185823316 CACGCTCGGGCTCCGCCTTCGGG + Intronic
968439787 4:617478-617500 CGCGCAGGGGCTCCCCCGAAAGG + Intergenic
968910215 4:3473658-3473680 CGGGCGGGGGCTCCCCGTTCAGG + Intronic
981871062 4:149486805-149486827 CAGGCCTGGGCTCACCCTTCAGG + Intergenic
987088074 5:14487797-14487819 CGCGCCGGGGGGCCGCCTGCTGG - Exonic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002795941 6:471088-471110 CCCGCCGGGGCTCTCCCACCCGG - Intergenic
1003098112 6:3157654-3157676 CGCGCCCCGGCTCCCCCTCGCGG - Intergenic
1005892834 6:30154124-30154146 CCTGCCGGGGCTGCTCCTTCAGG + Exonic
1008030391 6:46688098-46688120 CGCGGCGCGGCCCCCACTTCCGG - Intronic
1027421126 7:78019409-78019431 CGCGCCGGGGCGCCCCCCGGGGG + Exonic
1029269065 7:99365701-99365723 CAGGCCGGGGCTCCCCCTGCTGG - Intronic
1029425167 7:100490121-100490143 CCCCCCAGCGCTCCCCCTTCTGG + Intronic
1037980026 8:23246726-23246748 CCCGCCGGGTCTCCCCCGGCTGG - Exonic
1042297972 8:67242792-67242814 CAGGCCGGGACTCACCCTTCAGG - Intronic
1045547375 8:103140814-103140836 CGGGCCGGGGCTGCGCCTCCGGG + Exonic
1046108279 8:109691832-109691854 TCCGCCGGGGCTCCCTCATCTGG - Intergenic
1049564701 8:143332015-143332037 CTCCCCAGGGCGCCCCCTTCTGG + Intronic
1049785828 8:144450203-144450225 CGCGACGGGGCCCCCGCCTCCGG - Exonic
1061403167 9:130379304-130379326 CGCCCCGGGCCTCCTCCTCCCGG - Intronic
1062503937 9:136863258-136863280 TGCGCCGGGGCTCTCACTCCTGG - Intronic