ID: 1069837908

View in Genome Browser
Species Human (GRCh38)
Location 10:71320653-71320675
Sequence GGAGTTTAAAATAGACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069837899_1069837908 17 Left 1069837899 10:71320613-71320635 CCATGCGAATCCAGGCTGGGGAG No data
Right 1069837908 10:71320653-71320675 GGAGTTTAAAATAGACTTGCTGG No data
1069837903_1069837908 7 Left 1069837903 10:71320623-71320645 CCAGGCTGGGGAGGGGCTCTGCT No data
Right 1069837908 10:71320653-71320675 GGAGTTTAAAATAGACTTGCTGG No data
1069837896_1069837908 20 Left 1069837896 10:71320610-71320632 CCTCCATGCGAATCCAGGCTGGG No data
Right 1069837908 10:71320653-71320675 GGAGTTTAAAATAGACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069837908 Original CRISPR GGAGTTTAAAATAGACTTGC TGG Intronic