ID: 1069838135

View in Genome Browser
Species Human (GRCh38)
Location 10:71322149-71322171
Sequence CTGTCTCTAAGGAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069838135 Original CRISPR CTGTCTCTAAGGAGGGAAAC TGG (reversed) Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
904203332 1:28835973-28835995 CTGCCACTTAGGAGGGAGACTGG + Intronic
904231009 1:29072461-29072483 CTGTGTATAAGGATGAAAACTGG - Intronic
904313777 1:29646631-29646653 CTGCCTCTGAGGAGTGAAAAGGG + Intergenic
905391668 1:37639644-37639666 CTGTTTCCAAGGAGAAAAACTGG - Intergenic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
905687501 1:39919219-39919241 CTATCTCTGAGAAGGTAAACTGG - Intergenic
906515848 1:46438427-46438449 CTGAGTCCCAGGAGGGAAACTGG + Intergenic
906687232 1:47770543-47770565 CTGTCCCTCAGATGGGAAACTGG + Intronic
906783438 1:48593103-48593125 CTGTCTCTGGGGAGCAAAACTGG - Intronic
907434161 1:54433438-54433460 CTGTCTCTACGGAGGAAAGCTGG - Intergenic
907542883 1:55232704-55232726 CTGTCTCTGTGGAGGAAAATGGG + Intergenic
908343288 1:63205024-63205046 CTGGCTCTGAGGAAGGAAAGTGG - Intergenic
910277031 1:85460739-85460761 TTGCCTCTAAGGAGGAGAACTGG + Intronic
910438182 1:87226623-87226645 ACTTCACTAAGGAGGGAAACTGG + Intergenic
910792197 1:91063290-91063312 CTGGCGCTAAGGAGGAAAAGAGG + Intergenic
910807240 1:91201054-91201076 TTTTTTCTAAGGAGGGAAAGGGG - Intergenic
910814550 1:91277138-91277160 TTGTCTGAAAGGAAGGAAACTGG - Intronic
911417499 1:97593209-97593231 CTGTCCCTGAGGAGGTAAAATGG - Exonic
912420378 1:109538696-109538718 CTGCCTCTAAGAAGGAAAAAGGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
913374415 1:118134748-118134770 ATGTGTATAAGGAGGGAAATTGG - Intronic
915610410 1:156987544-156987566 TTGTCTCTGAGGAGGGAAACTGG + Intronic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
918778735 1:188669546-188669568 CTGACTCTAAGGAGGGCTATGGG - Intergenic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
919218968 1:194600707-194600729 TTATCTCTGGGGAGGGAAACTGG - Intergenic
920874934 1:209826101-209826123 CTGCCTCTGGGGAGGGAAACTGG + Intergenic
921388358 1:214594141-214594163 CTGTTTCTAAGGGGGGAAAAGGG + Intergenic
921762639 1:218934350-218934372 CTGTCTTTGAGCTGGGAAACTGG - Intergenic
922587925 1:226749855-226749877 CTGTCTCTAAGGATAGAGACTGG + Intergenic
923536253 1:234854314-234854336 TTGTCTCAAAAGAGGGAAGCCGG + Intergenic
924396308 1:243625062-243625084 CTGTCTCTAAAGTGGGGAAAGGG - Intronic
924778678 1:247128641-247128663 TTGTCTCTAAGGAGTGATAACGG - Intronic
924782976 1:247169777-247169799 TTGTCTCTAAGGAGTGATAACGG + Intronic
1064985683 10:21207692-21207714 CAGTCTGTAAGGAGGGAGCCAGG - Intergenic
1065436753 10:25710610-25710632 CTGTCCCTAAGGAAGTAAAGTGG - Intergenic
1066186768 10:33016969-33016991 ATGTCCCCAAAGAGGGAAACTGG - Intergenic
1066378391 10:34880267-34880289 CTGTCTCTAAAAAGAGAGACAGG - Intergenic
1067228470 10:44390562-44390584 CAGCCTCTGAGGAAGGAAACAGG - Intergenic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1070621082 10:78011646-78011668 CTCTCTCTGAGGTGGGATACAGG + Intronic
1072210667 10:93243949-93243971 CTGTCTTCAAGGTGGGAAACTGG - Intergenic
1072533862 10:96344628-96344650 CTGTCTCCAAGGAGGCCAAATGG - Exonic
1074122080 10:110500085-110500107 CTGTCTCTGGGGAGTGGAACTGG - Intronic
1075384427 10:122045026-122045048 CTATCTCTAAGACGGGGAACAGG + Intronic
1075767092 10:124901572-124901594 CTGTTACTAAAGAGGGAAAGGGG + Intergenic
1075955537 10:126520075-126520097 CTGTTTCTGATGAGGGCAACAGG - Intronic
1076195429 10:128514210-128514232 CTGTCTCTAAGGAGGGGAAAGGG - Intergenic
1077776544 11:5278433-5278455 GTTTCTTTAAGGAGGGAAAATGG + Intronic
1079288843 11:19167463-19167485 ATATTTCTAGGGAGGGAAACTGG - Intronic
1080390223 11:31838888-31838910 TTGCCTCTGAGGAGGGGAACTGG - Intronic
1081993898 11:47351783-47351805 GTGTCTCCAAGCAGGGAAAGTGG - Intronic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1083246989 11:61436345-61436367 TTCTCCCTAGGGAGGGAAACAGG - Intronic
1086351957 11:85951247-85951269 CTGTTTCTGACTAGGGAAACAGG + Intergenic
1086585968 11:88451475-88451497 CTGTCTAAAAGGAGAGAAAGAGG - Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1089423869 11:118353491-118353513 TTGTCTCTGAAGAGGGCAACAGG - Exonic
1089462010 11:118659088-118659110 CTCTCCCCAAGGAGGGAAAGAGG + Intronic
1090148951 11:124360425-124360447 ATTTCCCTAAGGAGGGAAAGAGG + Intergenic
1090715774 11:129429518-129429540 CTGTCTCTAAGGAAAAAAAACGG + Intronic
1091163695 11:133451062-133451084 ATGTCTCTAACGGGGGAAAAGGG + Intronic
1092260343 12:6950276-6950298 CTTCCCCTAGGGAGGGAAACTGG - Intronic
1095475598 12:42584310-42584332 ATGTCCCTAAAGAGGGAGACAGG + Intronic
1095809162 12:46353683-46353705 CTGTCAGTAAGGAGAGAAAGAGG + Intergenic
1096488851 12:52002654-52002676 CTGTCCCCTAGGAGGGAACCAGG + Intergenic
1097259445 12:57708220-57708242 CTTTCTTTAAGGATGGAAAGAGG - Intronic
1098381259 12:69872326-69872348 CTGTCCCTAAGGGGGAAAAAGGG - Intronic
1101918150 12:108911998-108912020 CAGGCTCTAGGGAGGCAAACCGG + Exonic
1102115857 12:110402738-110402760 CTGTCTCAAAAAAAGGAAACGGG - Intronic
1102361727 12:112293736-112293758 TTGCCTCTGAGGAGGGAAACTGG + Intronic
1103470134 12:121173764-121173786 CTGTCCCTAAGGAGAAATACTGG + Intronic
1103734522 12:123050843-123050865 CCTTCTCCAGGGAGGGAAACAGG + Intronic
1103920794 12:124398241-124398263 CTGGCTCAAAGGAGAGAAAAGGG - Intronic
1104240019 12:126979386-126979408 CTGCCTCTAAGAAGAGAGACTGG - Intergenic
1105907000 13:24821980-24822002 CTGTCTCTAGTGAGAGAAAGGGG + Intronic
1107630135 13:42334502-42334524 CTGAATCTGAGGAGGGAACCTGG - Intergenic
1107801525 13:44112530-44112552 CTGTTTCTAAGTGGGGAAAATGG - Intergenic
1108832723 13:54499619-54499641 CTTTCTCTAACTAGGGAAGCTGG + Intergenic
1113938748 13:114007876-114007898 GTGACTCTAAGCAGGGAATCTGG + Intronic
1114317099 14:21519508-21519530 CTGCCTGTAAGAAGGGAAAGAGG - Intergenic
1115544474 14:34453355-34453377 CTTTCTCTGAAGAGGGAGACTGG - Intronic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1115922014 14:38385452-38385474 TTGCCTCTGAGGAGGGAAATGGG + Intergenic
1117608668 14:57459904-57459926 TTGGCTCCAAGGAGGAAAACTGG - Intergenic
1119922411 14:78458583-78458605 CTGTCTCTAAGTTGGGGAAAAGG + Intronic
1120198695 14:81514718-81514740 CTGTCTTTCAGATGGGAAACAGG + Intronic
1120759857 14:88275335-88275357 AAGTCACTTAGGAGGGAAACAGG - Intronic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1122384074 14:101332044-101332066 TTGTCTCCAAGGAAGGAAAGTGG - Intergenic
1123631802 15:22266278-22266300 CTGTCTGCAAAGAGGGGAACTGG - Intergenic
1125009284 15:34852967-34852989 TTGTCTCTAAGAAGAAAAACTGG + Exonic
1126684928 15:51240231-51240253 CTGCCCCTAAGCAGGAAAACAGG + Intronic
1127326309 15:57898720-57898742 CATTTTCTAAGGAGGTAAACTGG - Intergenic
1128191100 15:65698262-65698284 CTGTCTCAAAGAATGGAAAAAGG + Intronic
1131401204 15:92126950-92126972 CTGGCTCTAGAGAGAGAAACTGG - Intronic
1132162300 15:99554160-99554182 CTTCCTCCAAGAAGGGAAACTGG - Intergenic
1134641301 16:15831235-15831257 GTGTCTCTAAGAAGGGGAACTGG + Intronic
1135357603 16:21782511-21782533 CTTTCTCTAGGGAGGAAATCAGG - Intergenic
1135456107 16:22598627-22598649 CTTTCTCTAGGGAGGAAATCAGG - Intergenic
1135492216 16:22919335-22919357 CAGTCTCTTAGGAGGAAAAATGG + Intergenic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1135941746 16:26827942-26827964 CATTCTCTAAGGTGGGAAGCAGG + Intergenic
1137501127 16:49012612-49012634 ATGTCTTTAAGGAGAGAAGCAGG - Intergenic
1137741666 16:50782573-50782595 CTGCCTCTGAGTAGAGAAACTGG + Intronic
1138243688 16:55449641-55449663 TTGTCTCTAAGGGGTGAAACTGG - Intronic
1138526425 16:57610347-57610369 CTGTCTTTGAGTGGGGAAACAGG + Intergenic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1141668787 16:85480622-85480644 CTGTCTCCCAGGAGGGCAATCGG - Intergenic
1142789364 17:2251774-2251796 CTGGCTCTCAGAAAGGAAACTGG + Intronic
1143369529 17:6429736-6429758 CTGTATGTTAGGAGTGAAACAGG - Intronic
1143578966 17:7813058-7813080 CTGCCTCTAAAGAAGGAACCTGG + Intronic
1144252360 17:13430419-13430441 CTGGCTCAAAGGAAGGATACTGG - Intergenic
1144832138 17:18137722-18137744 CTGTCTCCAAGGAGGTCCACTGG - Intronic
1148244758 17:46023460-46023482 CTGTCTCTGGGGAGGGTACCTGG + Intronic
1150956519 17:69866216-69866238 TTTTCTCTAAGCAGGGAAAAAGG + Intergenic
1153237366 18:3000808-3000830 CAGTCTCTTAGGAGGGAACACGG - Intronic
1153880170 18:9415591-9415613 CTGCCTCCAGGGAGGGAAAACGG + Intergenic
1155505001 18:26524726-26524748 CTGTCTCTAAAGAGGAAAATGGG + Intronic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1161305223 19:3563758-3563780 CTGTCCCTGATGAGGGGAACTGG - Intronic
1164535155 19:29080372-29080394 CTGTCCCTAAGGATGCAAAGAGG - Intergenic
1164885751 19:31777114-31777136 CTGTGTCCAAGAAGGCAAACTGG - Intergenic
1165375002 19:35435609-35435631 TTGTCTCTAAAGAAGGAAAAAGG - Intergenic
1166070783 19:40386356-40386378 CTGTCTCTAAAAAGGAAAAAAGG - Intronic
1167447031 19:49543659-49543681 CTGTCTCTATGAAGGGTAAGGGG + Intronic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
924998503 2:385462-385484 CTGACTCTCAGGAGGGACAGGGG - Intergenic
926332165 2:11834577-11834599 AGATCTCTAAGGAAGGAAACTGG + Intergenic
926780286 2:16464706-16464728 CTGTCTCTAAAGTGAGAAATGGG - Intergenic
927197491 2:20558533-20558555 CCGTTTCTGAAGAGGGAAACTGG - Intergenic
930084684 2:47487467-47487489 TTCTCTCTAAGGAGGGCAATGGG + Intronic
930168648 2:48229308-48229330 CTGTTTAAAAGGAGGCAAACTGG - Intergenic
931819000 2:65932961-65932983 CTGGCCCTAAGAATGGAAACAGG - Intergenic
932756249 2:74411904-74411926 TTGCCTCTCAGGAGGGGAACAGG + Intergenic
933856572 2:86419990-86420012 CTGTCTATAAGGACTGACACTGG + Intergenic
935203637 2:100879672-100879694 CTGTCTCTAAAAAGGGAATCAGG - Intronic
935332023 2:101984417-101984439 CAGTGTCTAATCAGGGAAACCGG - Intergenic
936881823 2:117262370-117262392 CTGTCTGTAAGGACTGAAAAAGG - Intergenic
937206720 2:120241278-120241300 CTGGCTCCTAGGAGGCAAACAGG - Intronic
937366194 2:121263826-121263848 CTGCCTCTGAGGAGGGGCACTGG + Intronic
939281571 2:140072305-140072327 TTGTATTTAAGAAGGGAAACGGG - Intergenic
940826613 2:158419760-158419782 CAGTTTCTAATGAGGGAAATGGG - Intronic
941260695 2:163292901-163292923 CTGTCTCTAAATAGTGACACTGG - Intergenic
944466321 2:200003527-200003549 CTTTCTCTCAGGAGGAAAGCAGG + Intronic
945334428 2:208575063-208575085 CTCTGTCTAATGATGGAAACGGG - Intronic
945617341 2:212088912-212088934 CTTTCTCTGAGCAGGGAATCTGG - Intronic
948179346 2:235967186-235967208 CTGGCTCCAAGGAGGGAGCCTGG - Intronic
948838410 2:240637204-240637226 CTGTAACACAGGAGGGAAACCGG - Intergenic
1168950978 20:1802143-1802165 CTGTCTCTAGGAAGGGGAACTGG + Intergenic
1168954072 20:1821992-1822014 CTGGCTCAAGGGAGGGAAATGGG - Intergenic
1170252613 20:14301774-14301796 CTATTTCAAAAGAGGGAAACAGG - Intronic
1170273792 20:14559894-14559916 CTGTCTCTCCGGTGTGAAACAGG + Intronic
1170351801 20:15449494-15449516 CTGCCTCTTAAGAGGGATACTGG - Intronic
1170698882 20:18685360-18685382 CTATGTATAAGGAGGAAAACAGG - Intronic
1171964478 20:31518995-31519017 CTGCCTCTGAGGAGGGAAATAGG - Intronic
1172487536 20:35307328-35307350 CTCTCCCTAAGTAGGGGAACAGG + Intronic
1173147459 20:40537083-40537105 CTGTCCCTGAGGAGGGAAAGGGG - Intergenic
1173201564 20:40958960-40958982 TTGTCTCTGAGGAGGGAATTGGG + Intergenic
1173214782 20:41070863-41070885 CTACCTCTAAAGAGAGAAACAGG - Intronic
1173272616 20:41551814-41551836 TTCTCTCTAAGGAGTGAGACAGG + Intronic
1178673413 21:34612187-34612209 ATGGCTTTCAGGAGGGAAACTGG - Intronic
1179007328 21:37527345-37527367 CTGCCGCTAAGCAGGCAAACTGG - Intergenic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1180958368 22:19751127-19751149 CTGGGTCTCAGGAGGGAACCGGG + Intergenic
1182276903 22:29195530-29195552 CTGCCTGTCAGGAGGGAAAGGGG + Intergenic
1184491882 22:44814655-44814677 TTGTACCTGAGGAGGGAAACGGG - Exonic
1185297336 22:50060886-50060908 CTGGGTCTAAGTAGGGAGACAGG + Exonic
951108646 3:18774924-18774946 CAGCCTCTCATGAGGGAAACTGG + Intergenic
960815319 3:121665946-121665968 CTGGCTCTCAGGAGGGAAGCAGG - Intronic
961372655 3:126440912-126440934 CTGGCTCTGAGTTGGGAAACAGG - Intronic
961656364 3:128444422-128444444 CTGTTTCTAAGGAAGAAAAGGGG + Intergenic
962713184 3:138104288-138104310 CTGTGTCTAAGGAGGAACATGGG + Intronic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
964873738 3:161342287-161342309 CTGGCTCCAAAGAGGGAAAAAGG - Intergenic
965462583 3:168985972-168985994 TTTTCTCTTAGGAGGAAAACTGG - Intergenic
965562620 3:170076111-170076133 TTGTATCTAGGGAGGGAAACTGG + Intronic
965670613 3:171143940-171143962 CTTTCTCTAAGATGGCAAACAGG - Intronic
966681170 3:182643574-182643596 CTGTCTCCAAGGAGGGGTCCTGG - Intergenic
967879793 3:194293386-194293408 CAGTCTCTCAGGAGAGCAACAGG + Intergenic
969638901 4:8385096-8385118 CTGTCTCGCAGAAGGAAAACAGG + Intronic
971127541 4:23770980-23771002 CTGCCCCTATGGAGGAAAACGGG + Intronic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
971228341 4:24776390-24776412 CTGTCTCTAAAGAGGAGAACTGG + Intergenic
973871854 4:55174597-55174619 CATCCTCTAAGGAGAGAAACTGG + Intergenic
977106681 4:92894810-92894832 TTGATTCTCAGGAGGGAAACAGG - Intronic
977423603 4:96836197-96836219 CTCGCTGTAAGGAAGGAAACTGG + Intergenic
977628139 4:99211232-99211254 CTGTCTCTAAGATGGGGAACTGG - Intronic
978630841 4:110742440-110742462 ATGTCTTGAAGGAAGGAAACAGG - Intergenic
978809443 4:112833893-112833915 TTGTCTCTGAGGAGGAGAACTGG - Intronic
981543337 4:145868794-145868816 CTGACCATAAGGAGGGAGACAGG + Intronic
982083504 4:151812728-151812750 TGGTCTATAAGGAGAGAAACTGG - Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983265269 4:165501445-165501467 CTGTCTCTAGGGAGGAAAATGGG - Intergenic
983637429 4:169912205-169912227 CTGCCTCCAGGGAAGGAAACTGG - Intergenic
986230504 5:5860408-5860430 CAGGGTCCAAGGAGGGAAACAGG + Intergenic
986529847 5:8724992-8725014 GTGTCTCTAAGAAGAGAAAAAGG - Intergenic
986617283 5:9631242-9631264 CTGTCTCTAAAGAGAGAGAGAGG - Intronic
988400678 5:30756035-30756057 CTGACTCTAGTGAGGGAAAAAGG + Intergenic
990729970 5:58797553-58797575 CTATCTCTATGGAGGGAAGGAGG - Intronic
991003126 5:61803078-61803100 GTGTCACTAATGAGTGAAACAGG + Intergenic
991257032 5:64625671-64625693 TTCTCTCTAAGAAGAGAAACAGG + Intergenic
992752150 5:79871656-79871678 CTGCCTCTAGGGAGGGGAACTGG - Intergenic
992961213 5:81958114-81958136 CTGACTCTGAGAAGGGAAAGTGG - Intergenic
993511737 5:88779018-88779040 ATGTCTCTCAGATGGGAAACTGG + Intronic
993752547 5:91688954-91688976 CTGTCACTAAGGAAGGACATTGG - Intergenic
995048083 5:107672002-107672024 CTGTGCCTAAGGAGGGAAAGAGG - Intergenic
995619784 5:114011849-114011871 CTGCCTTTAAGGAAGGAACCCGG - Intergenic
995928098 5:117400344-117400366 CTGTCTCTGAGAAGGAATACAGG - Intergenic
996047422 5:118889599-118889621 TTGTCTCTAAGAAGGAGAACTGG + Intronic
997516544 5:134493864-134493886 CAGCCTCTAAAGAGGGAAATGGG + Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
999135424 5:149315804-149315826 CAGCCTCTGAGGAGGGACACAGG - Exonic
1001439004 5:171723846-171723868 TTGTCTCTAAGGAAGAAAAAAGG - Intergenic
1001752407 5:174141773-174141795 CTGTCTGTAGGAAGGGCAACTGG + Intronic
1003281226 6:4693821-4693843 GTATCTCTAAGGAGAAAAACAGG + Intergenic
1003887069 6:10531466-10531488 CTTGCCCCAAGGAGGGAAACAGG - Intronic
1004154908 6:13159034-13159056 GTGGCTCAAAGGAGGGACACAGG - Intronic
1004821224 6:19369976-19369998 CTGTCTCTAAGGAGGGGTTCAGG + Intergenic
1008365915 6:50679931-50679953 TTGTCTGTAAATAGGGAAACAGG + Intergenic
1009636074 6:66266081-66266103 GTGTGTCTAAGGAGGAAAACAGG - Intergenic
1010148640 6:72702858-72702880 CTGATTCTAAGGAAGGAAAAAGG - Intronic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1010649653 6:78437320-78437342 CAGTCTCTAATGAGTAAAACAGG + Intergenic
1011812601 6:91150385-91150407 CTGGCTCTAAGGGGGCAAAGAGG + Intergenic
1013585642 6:111576030-111576052 CTGACTCCAAAGAGGGAAGCAGG + Intronic
1013855092 6:114562816-114562838 CCATCTCTAAGGAAGGAATCAGG + Intergenic
1014550071 6:122779767-122779789 CTGTCTCTAAAGAGGGGAAAGGG + Exonic
1014887759 6:126802696-126802718 CTGACACTATGCAGGGAAACAGG + Intergenic
1016350050 6:143156972-143156994 CTGACTCTGAAGAGGGAATCTGG + Intronic
1017082818 6:150685104-150685126 CTGTCTCCAATGAGTGACACTGG + Intronic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1018619125 6:165713682-165713704 CTCTCTATCAGGAGAGAAACAGG + Intronic
1019230789 6:170560456-170560478 CTGTCTCAAAGAAAGGAAGCAGG + Intronic
1021724117 7:23533058-23533080 CTGTCTCTAGGAGGGGGAACTGG - Intergenic
1022985102 7:35645856-35645878 TTGCCTCTAAGGAGGGCAAGTGG + Intronic
1023880088 7:44313334-44313356 CTTTCTCTGAGGAAGGAAAAAGG + Intronic
1025753614 7:64313862-64313884 CTGTCACTTAGGATTGAAACGGG + Intronic
1028596387 7:92550355-92550377 CTGCCTCTGAGGCAGGAAACGGG - Intergenic
1029571227 7:101370967-101370989 CCATCTGCAAGGAGGGAAACTGG - Intronic
1029606923 7:101604875-101604897 CTGTCTCTAAGGAATAAAAAAGG - Intergenic
1032064613 7:128757107-128757129 ATATATATAAGGAGGGAAACAGG - Intronic
1034242738 7:149622843-149622865 CTGGCTGTTTGGAGGGAAACAGG + Intergenic
1035281000 7:157778134-157778156 CTGTCCCCAGGGAGGAAAACAGG - Intronic
1036577904 8:10045437-10045459 GTGTCTTTCAGGAGGGAAGCGGG + Intergenic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038477603 8:27879076-27879098 CTTTTTTCAAGGAGGGAAACAGG - Intronic
1038498755 8:28025907-28025929 TTGCCTCTAAGGAGGGGAACTGG - Intronic
1038787908 8:30637964-30637986 CTGTCTCTAAAGAGCCAACCTGG + Intronic
1041041935 8:53855666-53855688 CAGTCTCTATTGAGGGAAACTGG + Intronic
1041344050 8:56877191-56877213 CTGAATCTAAGGAAGGAAAATGG - Intergenic
1041383382 8:57275469-57275491 CCTTCTCTCAGAAGGGAAACTGG + Intergenic
1047460935 8:125064700-125064722 CGGGCTCTTAGGAGGTAAACAGG + Intronic
1047926727 8:129689468-129689490 TTGGCTCTAAGGAGGGAAAAAGG - Intergenic
1050346692 9:4695791-4695813 CTGTCTCAAAGGAGATAAGCTGG - Intronic
1052235646 9:26210930-26210952 CTCTCTGTAAGGAGGGAAGGGGG - Intergenic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1053335514 9:37267197-37267219 CTGTCTCTAAGGATCAAAACAGG - Intronic
1055295115 9:74826082-74826104 CTGTACCAAAGGAGGGAAAAAGG + Intronic
1055518182 9:77054254-77054276 CTGACTCTAAAGAGGGAGATTGG - Intergenic
1056307279 9:85302477-85302499 GGATCTCTGAGGAGGGAAACTGG + Intergenic
1057623194 9:96654991-96655013 CTGCTTCTTAGGACGGAAACGGG - Intronic
1058094435 9:100843533-100843555 CTCTCTCTTAGGAGGGAATATGG + Intergenic
1058747094 9:108002374-108002396 CTCTCTGTAAAGAGGGAAAATGG - Intergenic
1058827597 9:108788713-108788735 CTGTCTATGAGGAAGCAAACAGG - Intergenic
1060819737 9:126654429-126654451 CTGTCTATGAGGTGGGGAACGGG + Intronic
1061286569 9:129626596-129626618 CTGTTTCTCGGAAGGGAAACAGG - Intronic
1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG + Intergenic
1189942972 X:46145896-46145918 ATGTCACTATTGAGGGAAACTGG - Intergenic
1190850516 X:54235981-54236003 TTGTGTCTAAGGAGAGAACCTGG + Intronic
1191764378 X:64681500-64681522 CTGTCCCTAGGGATGGACACAGG + Intergenic
1191887035 X:65899339-65899361 CTGTTCCTAATGAGAGAAACTGG + Intergenic
1192240815 X:69326540-69326562 CTGTCTCCCAGGAGGGAGAATGG - Intergenic
1195598176 X:106716756-106716778 CTGTCTCTAATGAAGGAGATAGG + Intronic
1195928214 X:110047649-110047671 CTGTCTCTATGGAGTAAAGCAGG + Intronic
1196941533 X:120781315-120781337 TTGCCTCTAGGGATGGAAACTGG - Intergenic
1197929897 X:131683446-131683468 CTGTCTCTAAGTCAGGAAACAGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1202272994 Y:23088428-23088450 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202293032 Y:23332254-23332276 CTGTCTAAAAGGAGGGATGCTGG + Intergenic
1202425991 Y:24722172-24722194 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202444798 Y:24947914-24947936 CTGTCTAAAAGGAGGGATGCTGG + Intergenic