ID: 1069842004

View in Genome Browser
Species Human (GRCh38)
Location 10:71345783-71345805
Sequence AACACACCCTCTCTCCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842004_1069842014 30 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842014 10:71345836-71345858 AGGAAGAGGGGAGACAGCCGTGG No data
1069842004_1069842012 17 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842012 10:71345823-71345845 GGAGCAGGAGGCGAGGAAGAGGG No data
1069842004_1069842013 18 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data
1069842004_1069842010 10 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842010 10:71345816-71345838 GCAGGCAGGAGCAGGAGGCGAGG No data
1069842004_1069842006 -4 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842006 10:71345802-71345824 TGTTGAGAGCCAGTGCAGGCAGG No data
1069842004_1069842007 2 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842007 10:71345808-71345830 GAGCCAGTGCAGGCAGGAGCAGG No data
1069842004_1069842011 16 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842011 10:71345822-71345844 AGGAGCAGGAGGCGAGGAAGAGG No data
1069842004_1069842009 5 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842009 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
1069842004_1069842005 -8 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842005 10:71345798-71345820 GGTGTGTTGAGAGCCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842004 Original CRISPR AACACACCCTCTCTCCTGCG AGG (reversed) Intronic