ID: 1069842008

View in Genome Browser
Species Human (GRCh38)
Location 10:71345811-71345833
Sequence CCTCCTGCTCCTGCCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842008_1069842016 6 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842016 10:71345840-71345862 AGAGGGGAGACAGCCGTGGTGGG No data
1069842008_1069842017 7 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842017 10:71345841-71345863 GAGGGGAGACAGCCGTGGTGGGG No data
1069842008_1069842015 5 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842015 10:71345839-71345861 AAGAGGGGAGACAGCCGTGGTGG No data
1069842008_1069842018 8 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842018 10:71345842-71345864 AGGGGAGACAGCCGTGGTGGGGG No data
1069842008_1069842022 29 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842022 10:71345863-71345885 GGGAGCCCTTGGCTCACTTATGG No data
1069842008_1069842019 9 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842019 10:71345843-71345865 GGGGAGACAGCCGTGGTGGGGGG No data
1069842008_1069842020 18 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842020 10:71345852-71345874 GCCGTGGTGGGGGGAGCCCTTGG No data
1069842008_1069842014 2 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842014 10:71345836-71345858 AGGAAGAGGGGAGACAGCCGTGG No data
1069842008_1069842013 -10 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842008 Original CRISPR CCTCCTGCTCCTGCCTGCAC TGG (reversed) Intronic