ID: 1069842013

View in Genome Browser
Species Human (GRCh38)
Location 10:71345824-71345846
Sequence GAGCAGGAGGCGAGGAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842004_1069842013 18 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data
1069842008_1069842013 -10 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data
1069842000_1069842013 28 Left 1069842000 10:71345773-71345795 CCCGGCTGCGCCTCGCAGGAGAG No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data
1069842001_1069842013 27 Left 1069842001 10:71345774-71345796 CCGGCTGCGCCTCGCAGGAGAGA No data
Right 1069842013 10:71345824-71345846 GAGCAGGAGGCGAGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842013 Original CRISPR GAGCAGGAGGCGAGGAAGAG GGG Intronic