ID: 1069842014

View in Genome Browser
Species Human (GRCh38)
Location 10:71345836-71345858
Sequence AGGAAGAGGGGAGACAGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842008_1069842014 2 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842014 10:71345836-71345858 AGGAAGAGGGGAGACAGCCGTGG No data
1069842004_1069842014 30 Left 1069842004 10:71345783-71345805 CCTCGCAGGAGAGAGGGTGTGTT No data
Right 1069842014 10:71345836-71345858 AGGAAGAGGGGAGACAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842014 Original CRISPR AGGAAGAGGGGAGACAGCCG TGG Intronic