ID: 1069842017

View in Genome Browser
Species Human (GRCh38)
Location 10:71345841-71345863
Sequence GAGGGGAGACAGCCGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842008_1069842017 7 Left 1069842008 10:71345811-71345833 CCAGTGCAGGCAGGAGCAGGAGG No data
Right 1069842017 10:71345841-71345863 GAGGGGAGACAGCCGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842017 Original CRISPR GAGGGGAGACAGCCGTGGTG GGG Intronic