ID: 1069842022 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:71345863-71345885 |
Sequence | GGGAGCCCTTGGCTCACTTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069842008_1069842022 | 29 | Left | 1069842008 | 10:71345811-71345833 | CCAGTGCAGGCAGGAGCAGGAGG | No data | ||
Right | 1069842022 | 10:71345863-71345885 | GGGAGCCCTTGGCTCACTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069842022 | Original CRISPR | GGGAGCCCTTGGCTCACTTA TGG | Intronic | ||