ID: 1069842400

View in Genome Browser
Species Human (GRCh38)
Location 10:71348002-71348024
Sequence GCATCCGCCAGCCTCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842400_1069842406 13 Left 1069842400 10:71348002-71348024 CCATTCCCGAGGCTGGCGGATGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1069842406 10:71348038-71348060 TCCTGCCATGCTGAGGCAGCAGG No data
1069842400_1069842408 14 Left 1069842400 10:71348002-71348024 CCATTCCCGAGGCTGGCGGATGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG No data
1069842400_1069842405 6 Left 1069842400 10:71348002-71348024 CCATTCCCGAGGCTGGCGGATGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1069842405 10:71348031-71348053 CTGGACTTCCTGCCATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842400 Original CRISPR GCATCCGCCAGCCTCGGGAA TGG (reversed) Intronic
900187341 1:1338573-1338595 GCAGCTGCCAGACTCGGGACTGG - Exonic
900191622 1:1354587-1354609 GGATCCGCGGGCCTCGGGCAAGG + Intronic
904434751 1:30487102-30487124 GCATCCGCAAGCCAAGGCAAGGG + Intergenic
905270888 1:36786733-36786755 CCAGCCGCCAGCCTTGGGATTGG + Intergenic
905346340 1:37313505-37313527 GCATTCGCCAGCCTGGAGCAGGG - Intergenic
905399316 1:37690412-37690434 GCGACCGGCAGCCTCGGGCAGGG - Exonic
912567295 1:110597221-110597243 GCATCCGTCTCCCTGGGGAAGGG + Intronic
914989089 1:152482802-152482824 GCATCCCCCCTCCTCTGGAAAGG - Intergenic
915143905 1:153783500-153783522 GCTTCCGTGAGCCCCGGGAAGGG + Intergenic
915630885 1:157153634-157153656 ACATCAGCCAGCCCCTGGAAGGG + Intergenic
922307448 1:224356834-224356856 GCCTCAGCCAGCCCCGGCAAGGG + Exonic
1067671979 10:48331964-48331986 GCATCCCCCTTCCTCTGGAAAGG - Intronic
1069842400 10:71348002-71348024 GCATCCGCCAGCCTCGGGAATGG - Intronic
1072859079 10:98983926-98983948 GCAGCAGCCAGGCTCGGGGAGGG + Intronic
1073434609 10:103508618-103508640 GCAAACGCCAGCCTCAGAAAGGG - Intronic
1075450083 10:122545079-122545101 GCATCATTCAGCCTCGGGAAAGG - Intergenic
1075526611 10:123192204-123192226 GCATCCCCGAGGCTCTGGAAAGG - Intergenic
1076909174 10:133378983-133379005 GCCTCCGCGAGCCTCCGGACTGG - Intergenic
1077074808 11:695536-695558 GCTTCCGCCGGCGGCGGGAACGG - Exonic
1077228756 11:1449492-1449514 GCATCAGACAGCCGCGGCAAAGG - Intronic
1080314769 11:30936414-30936436 GCATCCCCCTTCCTCTGGAAAGG - Intronic
1083724729 11:64622248-64622270 GCTTCCACCAGCCTCTGGAGAGG + Intronic
1083902743 11:65651505-65651527 GCTTCAGCCAGCCTAGGGAAGGG - Intergenic
1090258673 11:125303441-125303463 GCAGGCCCCAGGCTCGGGAAAGG + Intronic
1092312577 12:7374484-7374506 GCTGCCCCCAGCCGCGGGAAGGG + Exonic
1095898754 12:47306265-47306287 GCCTCCGCCAGCCCCAGAAAGGG - Intergenic
1097042471 12:56164114-56164136 GCAGCTGCCAGGCTGGGGAATGG + Intronic
1099413755 12:82361838-82361860 GCCTCGGCCAGCCTAGAGAAGGG + Intronic
1099907523 12:88790054-88790076 TCATCCTCCAGCCTCCAGAATGG - Intergenic
1103363302 12:120366704-120366726 GCGTCCTCCAGCCTGGGAAAGGG - Intronic
1112112765 13:96320975-96320997 GCATGCACCAGCCCCAGGAAGGG - Intronic
1114642356 14:24232141-24232163 GCGTCCTCCAGGCTAGGGAAAGG + Intronic
1122812092 14:104294070-104294092 ACAGCCGCCAGCCTCAGGACAGG - Intergenic
1122969385 14:105146336-105146358 GCGTGCACCAGCCTCGGGTAGGG + Intronic
1127123963 15:55794338-55794360 CCATCCGCCAGACTCCAGAATGG + Intergenic
1132561878 16:598946-598968 GCAGCCGCCGGCCCCGGGCAGGG - Intronic
1132589083 16:718533-718555 GCATCCGCTAACCTAGAGAAAGG - Exonic
1133047892 16:3099258-3099280 GCCTCCGCCAGCCTGGGGAAGGG + Intronic
1137372673 16:47923051-47923073 CCATCCTCCATCCTCTGGAAAGG + Intergenic
1138720367 16:59072676-59072698 GCAGCAGCGAGCCTGGGGAAGGG + Intergenic
1141277421 16:82601297-82601319 GCATCAGCCAGGCCTGGGAATGG - Intergenic
1142764439 17:2057510-2057532 GCCTCCTCCAGCTTCTGGAAGGG - Exonic
1146055954 17:29581295-29581317 GCATCCAACAGCCTCTGGAAAGG + Intronic
1146450590 17:32970981-32971003 GCATCCCCCTTCCTCTGGAAAGG + Intronic
1150762481 17:67974934-67974956 CCATCCCCCAACCTCCGGAAGGG - Intronic
1151909384 17:77071800-77071822 GCAACGGCCAGCCTCAGGGATGG + Intergenic
1153960378 18:10135126-10135148 GCATCTGCCAGCCTTGGACAGGG + Intergenic
1153961676 18:10145437-10145459 GCATCTGCCAGCCTTGGACAGGG + Intergenic
1159917834 18:74202076-74202098 GCTTCCTCCAGCCTCTGGAGAGG - Intergenic
1161393068 19:4031390-4031412 GCCTCCTCCAGGCTCGGGGATGG + Intronic
1162958676 19:14113699-14113721 GAATCAGCCAGCCTCGAGTAGGG - Intronic
1165825958 19:38705856-38705878 GCATCCGTCTGCATCCGGAATGG + Intronic
1167769469 19:51505338-51505360 GCATCCACCACCTTGGGGAATGG - Intergenic
930816905 2:55607731-55607753 CCATCCGCCATCCTCCAGAAGGG - Intronic
942133978 2:172907065-172907087 GCAACCACCAGACTGGGGAAGGG - Intronic
943549328 2:189319599-189319621 GCAGCAGCCAGGCTCGGGGAGGG + Intergenic
945931031 2:215854902-215854924 GCATCCTCCAGACTCCAGAATGG + Intergenic
948801644 2:240435927-240435949 GCAGCCACCAGCCTCGGGCCCGG - Exonic
1170565971 20:17605568-17605590 GCAGCAGCAAGGCTCGGGAAAGG - Intronic
1171113180 20:22502512-22502534 GTCTCTGCCAGCCTCCGGAAAGG - Intergenic
1172845602 20:37928234-37928256 GAATCCGCCATCCTGGGGGAGGG + Intronic
1175932526 20:62499374-62499396 CCATCCCCCTGCCTGGGGAAGGG + Intergenic
1177775527 21:25562163-25562185 GCCGCCTGCAGCCTCGGGAAGGG + Intergenic
1179374021 21:40833400-40833422 GCCTCCGCCAGCCGCAGAAAAGG + Intronic
1182770099 22:32788884-32788906 GCACCCACCTGCCTGGGGAAAGG + Intronic
1184970275 22:48015055-48015077 GCCTCCTCCAGCCTTGAGAAAGG - Intergenic
955068759 3:55554899-55554921 GCTTACCCCAGCCTCTGGAAAGG + Intronic
955667335 3:61364418-61364440 GCATCAGCGAGCCTGGGGGAGGG + Intergenic
956403356 3:68903226-68903248 GCAACTGCCAGCCTCGAGAATGG + Intronic
968547255 4:1205628-1205650 GCCTACGGCAGCCTTGGGAAGGG + Intronic
969626711 4:8309326-8309348 GCAGCCGGCAGCCTCTGCAAAGG - Intergenic
970191398 4:13522711-13522733 GCATCTGCCAGCTTGGGGCAGGG - Intergenic
972954292 4:44369761-44369783 GCACCCGCAAGCCTGGGCAACGG + Intronic
976977268 4:91180517-91180539 GCAGCAGCCAGGCTGGGGAAGGG - Intronic
979624176 4:122827206-122827228 GCTGCCGCCATCCTCGGGCAAGG - Exonic
980739205 4:136928947-136928969 GCCTCGGCCAGCCTAGGGAGGGG - Intergenic
981300190 4:143178344-143178366 GCATCCCCCTTCCTCTGGAAAGG - Intergenic
985658531 5:1144186-1144208 GCACCCGCCAACCTCAGGGAGGG + Intergenic
987494831 5:18630235-18630257 CCATCCTCCAGACTCCGGAATGG - Intergenic
991435618 5:66595370-66595392 GCATCCTCCAGCCCCAGGGAAGG + Intergenic
994197292 5:96935294-96935316 GCAGCCGCCAGCCCCGGGACTGG + Intronic
997064378 5:130544721-130544743 GCATCCTCCTTCCTCTGGAAAGG - Intergenic
998341043 5:141418289-141418311 GAATCCGTCAGCCTGGGGATGGG + Exonic
999367969 5:151035187-151035209 GCGTGGGCCAGCCCCGGGAAAGG + Intronic
1001239430 5:170056827-170056849 GCATCGGCCAGCCTCAGAATGGG + Intronic
1003178432 6:3771579-3771601 GCCTCGGCCAGCCTAGAGAAGGG - Intergenic
1005913024 6:30327114-30327136 GCCTCCGCCCGCCTCGGGCCCGG + Intronic
1007625972 6:43246642-43246664 GCATCCGCCAGCCAGAGGGAGGG - Exonic
1007692542 6:43712008-43712030 GCACCCACCTGCCTTGGGAAGGG - Intergenic
1009667685 6:66704975-66704997 GCCTCCGCCAGCCCAGAGAAGGG + Intergenic
1017446269 6:154510016-154510038 GAGTCCTCCAGCCTCGGGGATGG - Intronic
1019064276 6:169283011-169283033 GCAGCCGCCTTCATCGGGAATGG + Intergenic
1019564687 7:1673514-1673536 CAATCCACCAGCCTTGGGAAAGG - Intergenic
1019660738 7:2222698-2222720 GCATCCGGCAGCTTCAGGAGCGG - Exonic
1021522350 7:21550616-21550638 GCATCCCCCTTCCTCTGGAAAGG - Intronic
1022262773 7:28722408-28722430 CCATCCACCAGCCTCTGGAAGGG + Intronic
1022405404 7:30085295-30085317 GCATCAGACAGCCTCTGGAATGG + Intronic
1024031848 7:45468201-45468223 GCAGCAGCCAGCCTGGGGGAGGG - Intergenic
1034417398 7:150972269-150972291 GCCTGGGCCAGCCTCGGGTAGGG - Intronic
1035075391 7:156174346-156174368 GCACCTGCCAGCCCCGGGAAGGG + Intergenic
1036396984 8:8378026-8378048 GCATCCTCCTGCTTCGGGAGGGG + Exonic
1036595183 8:10205427-10205449 GCATCCCCCACCTTTGGGAATGG - Intronic
1037724019 8:21468219-21468241 GCATCCTTCAGCCTGTGGAATGG + Intergenic
1038288894 8:26230875-26230897 GCTTCCTCCAGCCTGGGGCAGGG - Intergenic
1040055769 8:43056084-43056106 GCATCGGCAAAGCTCGGGAACGG + Intronic
1042185985 8:66136515-66136537 CCATCAGCCAGTCTTGGGAAGGG + Intronic
1046129307 8:109946930-109946952 GCATCCTCCAGACTCCAGAATGG + Intergenic
1048325235 8:133434136-133434158 GCATCCTCCAGCCCCAGCAAAGG - Intergenic
1048829900 8:138465812-138465834 GCATACTCCAGCCTGGGCAACGG - Intronic
1053562306 9:39209534-39209556 GCAGCCTCCAGCCTGGAGAAGGG + Intronic
1053828111 9:42047522-42047544 GCAGCCTCCAGCCTGGAGAAGGG + Intronic
1054134810 9:61409424-61409446 GCAGCCTCCAGCCTGGAGAAGGG - Intergenic
1054602446 9:67139924-67139946 GCAGCCTCCAGCCTGGAGAAGGG - Intergenic
1057934158 9:99222454-99222476 GCTTCCCCCAGCCTCGGGTGTGG + Intronic
1061944993 9:133903600-133903622 GCCTCAGCCAGCCTCGGGTCCGG + Intronic
1062658332 9:137615387-137615409 GCACCCTCCAGCCTCTGGCAGGG + Exonic
1185468971 X:371352-371374 GCGACCGCCGGCCTTGGGAACGG - Intronic
1197856556 X:130919400-130919422 TCATCCTCCAGACCCGGGAATGG - Intergenic
1200091921 X:153640023-153640045 GGAACCGCCAGCCCCGGGCAAGG - Intergenic
1200114564 X:153764532-153764554 GCCAACGCCAGCCTCGGGCAGGG + Intronic