ID: 1069842401

View in Genome Browser
Species Human (GRCh38)
Location 10:71348007-71348029
Sequence TGGAAGCATCCGCCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842401_1069842408 9 Left 1069842401 10:71348007-71348029 CCCGAGGCTGGCGGATGCTTCCA No data
Right 1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG No data
1069842401_1069842406 8 Left 1069842401 10:71348007-71348029 CCCGAGGCTGGCGGATGCTTCCA No data
Right 1069842406 10:71348038-71348060 TCCTGCCATGCTGAGGCAGCAGG No data
1069842401_1069842405 1 Left 1069842401 10:71348007-71348029 CCCGAGGCTGGCGGATGCTTCCA No data
Right 1069842405 10:71348031-71348053 CTGGACTTCCTGCCATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842401 Original CRISPR TGGAAGCATCCGCCAGCCTC GGG (reversed) Intronic
No off target data available for this crispr