ID: 1069842408

View in Genome Browser
Species Human (GRCh38)
Location 10:71348039-71348061
Sequence CCTGCCATGCTGAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069842402_1069842408 8 Left 1069842402 10:71348008-71348030 CCGAGGCTGGCGGATGCTTCCAG 0: 1
1: 0
2: 4
3: 21
4: 261
Right 1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG No data
1069842401_1069842408 9 Left 1069842401 10:71348007-71348029 CCCGAGGCTGGCGGATGCTTCCA No data
Right 1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG No data
1069842400_1069842408 14 Left 1069842400 10:71348002-71348024 CCATTCCCGAGGCTGGCGGATGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069842408 Original CRISPR CCTGCCATGCTGAGGCAGCA GGG Intronic
No off target data available for this crispr