ID: 1069842408 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:71348039-71348061 |
| Sequence | CCTGCCATGCTGAGGCAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069842402_1069842408 | 8 | Left | 1069842402 | 10:71348008-71348030 | CCGAGGCTGGCGGATGCTTCCAG | 0: 1 1: 0 2: 4 3: 21 4: 261 |
||
| Right | 1069842408 | 10:71348039-71348061 | CCTGCCATGCTGAGGCAGCAGGG | No data | ||||
| 1069842401_1069842408 | 9 | Left | 1069842401 | 10:71348007-71348029 | CCCGAGGCTGGCGGATGCTTCCA | No data | ||
| Right | 1069842408 | 10:71348039-71348061 | CCTGCCATGCTGAGGCAGCAGGG | No data | ||||
| 1069842400_1069842408 | 14 | Left | 1069842400 | 10:71348002-71348024 | CCATTCCCGAGGCTGGCGGATGC | 0: 1 1: 0 2: 1 3: 8 4: 110 |
||
| Right | 1069842408 | 10:71348039-71348061 | CCTGCCATGCTGAGGCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069842408 | Original CRISPR | CCTGCCATGCTGAGGCAGCA GGG | Intronic | ||
| No off target data available for this crispr | |||||