ID: 1069844254

View in Genome Browser
Species Human (GRCh38)
Location 10:71359713-71359735
Sequence AGGAGGAAGCAGGCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069844251_1069844254 -9 Left 1069844251 10:71359699-71359721 CCTCCATTTTACAGAGGAGGAAG 0: 3
1: 39
2: 269
3: 1091
4: 2731
Right 1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069844254 Original CRISPR AGGAGGAAGCAGGCCCAGAG AGG Intronic
No off target data available for this crispr