ID: 1069845086

View in Genome Browser
Species Human (GRCh38)
Location 10:71365444-71365466
Sequence CAGTTAGTGTGGAGCACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069845081_1069845086 -4 Left 1069845081 10:71365425-71365447 CCATTAGAGAGATGATTTGCAGT No data
Right 1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069845086 Original CRISPR CAGTTAGTGTGGAGCACAGG GGG Intergenic
No off target data available for this crispr