ID: 1069847074

View in Genome Browser
Species Human (GRCh38)
Location 10:71379818-71379840
Sequence CAGTGTCCACAAAGTGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069847074_1069847080 4 Left 1069847074 10:71379818-71379840 CCGAGTGCACTTTGTGGACACTG No data
Right 1069847080 10:71379845-71379867 CCTGAAATAGTGGGGCACACTGG No data
1069847074_1069847081 20 Left 1069847074 10:71379818-71379840 CCGAGTGCACTTTGTGGACACTG No data
Right 1069847081 10:71379861-71379883 ACACTGGCCTGAGAGCTCCCTGG No data
1069847074_1069847078 -4 Left 1069847074 10:71379818-71379840 CCGAGTGCACTTTGTGGACACTG No data
Right 1069847078 10:71379837-71379859 ACTGCTGGCCTGAAATAGTGGGG No data
1069847074_1069847077 -5 Left 1069847074 10:71379818-71379840 CCGAGTGCACTTTGTGGACACTG No data
Right 1069847077 10:71379836-71379858 CACTGCTGGCCTGAAATAGTGGG No data
1069847074_1069847076 -6 Left 1069847074 10:71379818-71379840 CCGAGTGCACTTTGTGGACACTG No data
Right 1069847076 10:71379835-71379857 ACACTGCTGGCCTGAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069847074 Original CRISPR CAGTGTCCACAAAGTGCACT CGG (reversed) Intergenic
No off target data available for this crispr