ID: 1069847531

View in Genome Browser
Species Human (GRCh38)
Location 10:71383084-71383106
Sequence TGGGTTAGGAGTCCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069847526_1069847531 0 Left 1069847526 10:71383061-71383083 CCTCTCTATACACTGACTGGGCC No data
Right 1069847531 10:71383084-71383106 TGGGTTAGGAGTCCTGTTCCAGG No data
1069847525_1069847531 1 Left 1069847525 10:71383060-71383082 CCCTCTCTATACACTGACTGGGC No data
Right 1069847531 10:71383084-71383106 TGGGTTAGGAGTCCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069847531 Original CRISPR TGGGTTAGGAGTCCTGTTCC AGG Intergenic
No off target data available for this crispr